جداسازی و همسانه‌سازی (cloning) cDNA ژن منگنز پراکسیداز (mnp) از قارچ خوراکی دکمه‌ای سفید (Agaricus bisporus)، مقدمه‌ای بر دست‌ورزی ژنتیکی

نویسندگان

گروه بیوتکنولوژی و به‌نژادی گیاهی، دانشکده کشاورزی، دانشگاه فردوسی مشهد، ایران

چکیده

   تولید و پرورش قارچ ‌ خوراکی، یکی از کاربردهای تجاری فناوری ‌ های میکروبی به منظور تبدیل زیستی ضایعات بخش کشاورزی به فرآورده ‌ های با ارزش غذایی است. در قارچ­ خوراکی دکمه‌ای ( ‌Agaricus ‌bisporus ) آنزیم‌های مختلفی از ابتدای رشد میسلیومی تا انتهای دوره میوه­دهی، تجزیه ترکیبات لیگنینی را در محیط کمپوست برعهده دارند. یکی از مهمترین این آنزیم‌ها، آنزیم منگنز پراکسیداز است که سهم عمده­ای در تجزیه ترکیبات لیگنینی دارد. به منظور انجام مطالعات ملکولی بر روی آنزیم منگنز پراکسیداز در قارچ خوراکی دکمه­ای سفید نژاد IM008 و آماده نمودن زمینه برای افزایش تولید این آنزیم در قارچ خوراکی دکمه­ای، اقدام به جداسازی و همسانه‌سازی cDNA ژن کدکننده آنزیم منگنز پراکسیداز گردید. برای این منظور استخراج RNA از میسلیوم­های رشد یافته قارچ خوراکی بر روی محیط‌کشت مایع عصاره کمپوست انجام شد و cDNA آن به‌وسیله آنزیم رونوشت بردار معکوس ساخته شد. پس از تکثیر قطعه مورد نظر به‌وسیله واکنش زنجیره‌ای پلیمراز، قطعه تکثیرشده در ناقل pTZ57R/T قرار گرفت و سپس به باکتری E.coli سویه DH5α منتقل گشت. پس از استخراج پلاسمید از باکتری‌های تراریخته، پلاسمید استخراج شده مورد هضم آنزیمی قرار گرفت و در مرحله آخر قطعه تکثیرشده تعیین توالی شد. در نتایج، بلاست توالی نوکلئوتیدی در مکان­های بازهای نوکلئوتیدی با شماره‌های 657 و 850 با توالی ژن mnp موجود در بانک اطلاعاتی NCBI تفاوت داشت که به ترتیب، سبب تغییر اسید آمینه­ ایزولوسین به والین و اسید آمینه سرین به آلانین در توالی اسیدآمینه قطعه cDNA ‌ همسانه شده، می­شود.

کلیدواژه‌ها


عنوان مقاله [English]

Isolation and cloning of cDNA manganese peroxidase gene (mnp) from white button Mushroom (Agaricus bisporus), introduction to genetic manipulation

نویسندگان [English]

  • Javad Hassan Janpoor
  • Mohammad Farsi
1 Department of Biotechnology and Plant breeding, Faculty of Agriculture, Ferdowsi University of Mashhad, Iran
چکیده [English]

Mushrooms, in addition to their nutritional values, are currently considered as useful tools for biological of agricultural wastes to useful food products. In the button mushroom (Agaricus bisporus), there are several enzymes which catalyze lignin compounds of the compost during the mycelia growth and the fructification phases. Manganese Peroxidase (MnP), as one of the most important lignin-degrading enzymes, plays a key role in degradation of lignin compounds in the button mushroom. To achieve a high yield of MnP in the A. bisporus, the gene encoding MnP was isolated, characterized and cloned. The total RNA was extracted from the mycelium growing on the liquid compost extract medium, followed by construction of its cDNA by reverse transcriptase. The PCR products were then inserted into the pTZ57R/T cloning vector, and transferred into E. coli (the DH5α strain). Finally, the plasmid was extracted from the transgenic bacteria, followed by enzymatic digestion and nucleotide sequencing. The BLAST analysis revealed two different nucleotides (657 and 850) between the cloned fragment (generated in this research) and the mnp1 (available in the gene bank of NCBI). The difference in the nucleotide positions of 657 and 850 subsequently changed Isoleucine to Valine and Serin to Alanine, respectively.

کلیدواژه‌ها [English]

  • Reverse transcriptase enzyme
  • Agriculture wastes
  • pTZ57R/T vector
  • Molecular cloning

 

یکی از‌ مشکلات‌ موجود ‌در صنعت ‌پرورش ‌قارچ‌ خوراکی ‌دکمه‌ای ‌سفید (‌Agaricus ‌bisporus)، کاهش‌ و‌ یا‌ توقف ‌تولید‌ در‌ برداشت‌های ‌دوم به بعد ‌است ‌که‌ بنظر می‌رسد عامل اصلی این مشکل، ‌اتمام ‌مواد ‌غذایی ‌برای‌ مصرف ‌قارچ ‌دکمه‌ای ‌و ناتوانی در ‌استفاده ‌بهینه ‌و ‌کامل ‌از‌ کمپوست ‌تولید‌ شده‌ باشد. با افزایش دما در انتهای مراحل اولیه (فاز I) تهیه کمپوست قارچ ‌دکمه‌ای، میکرواورگانیسم­های گرمادوست (قارچ‌ها، باکتری‌ها و اکتینومیست‌ها) به میزان زیادی تکثیر می‌شوند، ‌اما این ‌توده زنده ‌میکروبی ‌تنها ‌10 درصد ‌نیاز‌ غذایی ‌قارچ دکمه‌ای ‌را ‌می‌تواند ‌تأمین ‌کند (Moloy, 2004).

محققان ‌دریافته­اند که‌ در قارچ خوراکی دکمه­ای، آنزیم­های مختلفی از ابتدای رشد میسلیومی تا انتهای دوره میوه­دهی تجزیه ترکیبات لیگنینی را در محیط کمپوست بر عهده دارند. پس ‌از‌ اتمام‌ فرآیند ‌کمپوست‌سازی‌، اساساً ‌کمپوست ‌شامل‌ دو ‌ترکیب ‌اصلی‌غذایی، ‌لیگنوسلولز ‌و ‌بیومس ‌میکروبی است. ‌محتوای ‌لیگنوسلولز شامل‌ لیگنین،‌ سلولز‌ و ‌همی‌سلولز ‌با ‌نسبت 3:3:1‌ است. در نتیجه، استفاده ‌قارچ خوراکی دکمه‌ای (A.‌ bisporus) ‌از ‌کمپوست، ‌نیازمند ‌توانایی ‌تولید ‌مجموعه­ای ‌از ‌آنزیم‌های‌ تجزیه‌کننده ترکیبات  لیگنینی است (Moloy, 2004).

مطالعات انجام شده توسط محققان مختلف تأثیر آنزیم‌های لاکاز، منگنز پراکسیداز، لیگنین پراکسیداز و گلی­اکسال اکسیدازها را در فرآیند تجزیه ترکیبات لیگنینی در محیط این ویترو در قارچ­های تجزیه‌کننده ترکیبات لیگنین اثبات کرده است. البته، فعالیت این آنزیم­ها به نوع قارچ مورد مطالعه بستگی دارد (Kamitsuji et al., 2004). از این بین آنزیم منگنز پراکسیداز، یکی از عمومی‌ترین و اصلی‌ترین پراکسیدازهای تخریب‌کننده لیگنین است که با قدرت بالا در اکسیده‌کردن ترکیبات گیاهی توسط اکثر قارچ‌های تجزیه‌کننده چوب و نیز بسیاری از قارچ‌های تجزیه‌کننده کمپوست از جمله قارچ خوراکی دکمه­ای
(A. bisporus) تولید می‌شود. آنزیم منگنز پراکسیداز قدرتمندترین آنزیم برون سلولی اکسیده­کننده ترکیبات لیگنینی در قارچ خوراکی دکمه­ای سفید محسوب می­شود (Moloy, 2004).این آنزیم برون سلولی معمولاً دارای جرم مولکولی kDa 50-40 (حداکثر kDa 62-38) است و pI معمولاً حدود 4-3 است (Hofrichter, 2002).

قارچ‌های ‌مختلفی ‌از‌دسته بازیدیومیست‌ها ‌دارای آنزیم‌هایی برای ‌تجزیه ترکیبات لیگنینی ‌هستند. ‌تحقیقات‌ مختلفی ‌برای ‌شناسایی،‌ تعیین خصوصیات ‌و ‌همچنین ‌توالی‌یابی ‌ژن­های ‌دخیل ‌در ‌تجزیه ‌لیگنین ‌در‌ این‌ قارچ‌ها ‌انجام ‌شده ‌است (Ma et al., 2004).  بنابراین، ‌با دست‌ورزی ژن‌های دخیل در تولید آنزیم‌های مؤثر در فرآیند تجزیه لیگنین و همچنین بهینه‌ نمودن شرایط مناسب برای عمل این آنزیم‌ها می‌توان بستر مناسبی را برای فعالیت بیشتر قارچ خوراکی دکمه­ای سفید (A.‌ bisporus) و استفاده بیشتر آن از کمپوست تهیه شده فراهم نمود.

اطلاعات اندکی در مورد چگونگی تولید آنزیم منگنز پراکسیداز در بازیدیومیست‌ها در مقایسه با دیگر قارچ‌های پوسیدگی سفید وجود دارد (Chen et al., 2001)، اما تعدادی از گزارش­ها تولید آنزیم منگنز پراکسیداز توسط قارچ‌های تجزیه‌کننده کمپوست را تأیید می­کنند. مهمترین قارچ تجزیه‌کننده کمپوست که آنزیم منگنز پراکسیداز را هم تولید می‌کند، قارچ خوراکی دکمه‌ای سفید
(A.‌ bisporus) است (Lankinen et al., 2001). همچنین گونه‌هایی از خانواده قارچ‌های کوپرینوس، مانند Paneolus sphinctrinus (Heinzkill et al., 1998) و از قارچ‌های تجزیه‌کننده ترکیبات گیاهی، مانند Marasmius quercophilus (Tagger et al., 1998)، نیز آنزیم منگنز پراکسیداز را تولید می‌کنند.

cDNA‌‌ ژن اصلی تولید‌کننده آنزیم منگنز پراکسیداز از قارچ خوراکی صدفی توسط Irie و همکاران (2001) جداسازی و تعیین توالی گردید. جداسازی و خصوصیت‌یابی ژن منگنز پراکسیداز از قارچ خوراکی دکمه‌ای نژاد ATCC 62459 در سال 2005 توسط Lankinen و همکاران انجام شد. در این مطالعه 14 اینترون­ در ژن منگنز پراکسیداز شناسایی شده و تعداد نوکلئوتیدها در ژن کامل bp 1821 مشخص گردیده است. در پژوهش مذکور عنوان شده است که گمان می­رود ژن منگنز پراکسیداز جداسازی و کلون شده و یکی از زیرواحدها و یا یکی از نسخه­های ژن منگنز پراکسیداز شناسایی شده است. همچنین Lankinen و همکاران (2005) بر لزوم انجام تحقیقات بیشتر در این خصوص اشاره کرده­اند. جداسازی و خصوصیت‌یابی ژن کدکننده آنزیم منگنز پراکسیداز از قارچ خوراکی شی‌تاکه نیز در سال 2007 توسط Nagai و همکاران صورت گرفت.

هدف از اجرای این پژوهش، جداسازی و همسانه­سازی ژن منگنز پراکسیداز (mnp)، از قارچ خوراکی دکمه‌ای سفید (A.‌ bisporus)نژاد  IM008(از نژادهای هیبرید اصلاحی در جهاد دانشگاهی واحد مشهد) است. بهینه‌سازی مراحل استخراج RNA و تهیه cDNA از قارچ خوراکی دکمه‌ای به منظور هموار نمودن مسیر برای انجام دست‌ورزی­های ژنتیکی و انتقال ژن به قارچ ‌خوراکی دکمه‌ای (A.‌ bisporus)نیز از اهداف پیگیری‌شده در این پژوهش است. کاهش عملکرد قارچ ‌خوراکی ‌دکمه‌ای ‌سفید به‌دلیل اتمام مواد غذایی و‌ یا عدم استفاده بهینه از کمپوست آماده ‌شده، از جمله مواردی است که خسارت‌های زیادی را متوجه پرورش‌دهندگان قارچ‌خوراکی می‌کند (Nagai et al., 2007).

بنابراین، با شناسایی هرچه بیشتر ژن‌های تجزیه­کننده ترکیبات گیاهی و لیگنینی، تولید نژادی هیبرید (بین گونه‌های با قدرت بیشتر تجزیه­کنندگی و نژادهای دارای کیفیت) و یا تراریخته (انتقال ژن­های تولید آنزیم­های تجزیه ترکیبات گیاهی به گونه­هایی با تجزیه­کنندگی پایین) از قارچ خوراکی که به‌دلیل تولید آنزیم­های مؤثر و با قدرت تجزیه­کنندگی بیشتر توانایی استفاده بهتر از کمپوست آماده شده را دارند، می‌توان انتظار داشت که عملکرد قارچ خوراکی در واحد سطح تا چندین برابر مقدار کنونی افزایش یابد، در حالی‌که از کیفیت و خصوصیات مطلوب آن کاسته نشده است.

 

مواد و روش­ها

در این تحقیق، از قارچ خوراکی دکمه‌ای نژاد IM008 که در گروه پژوهشی قارچ های خوراکی و صنعتی جهاد دانشگاهی واحد مشهد اصلاح شده است، استفاده گردید. روش کشت بافت قارچ خوراکی از میسلیوم تازه مطابق با روش بیان شده توسط فارسی و گردان (1386) بود. برای این منظور، قطعه‌ای از میسلیوم رشد‌ یافته قارچ خوراکی در محیط‌کشت جامد به یک پتری 9 سانتی‌متری حاوی محیط‌کشت تازه منتقل گردید. محیط‌کشت در دمای °C1±23 در تاریکی به مدت حدود 10 روز نگهداری شد. کشت مایع قارچ خوراکی دکمه­ای نیز مطابق با روش تشریح شده توسط قربانی فعال (1387) با کمی تغییرات انجام گرفت. از یک کشت 14-10 روزه جامد میسلیومی قطعه مثلثی شکلی به طول اضلاع 25 میلی‌متر با کمترین میزان آگار جداسازی گردید. در هر ویال، یک برش میسلیومی به صورت غوطه‌ور در محیط‌کشت مایع قرار داده شد و به منظور رشد میسلیوم‌ها، محیط‌های کشت در دمای °C1±23 و در تاریکی نگهداری شدند.

استخراج RNA کل سلول با استفاده از کیت تجاری RNA-X plus شرکت سیناژن، روش مبتنی بر گوانیدین تیوسیانات-فنل-کلروفرم (AGPC) (Chomszynski and Sacchi, 1987) و روش مبتنی بر کلرید لیتیم (Sreenivasaprasad, 2000) انجام شد. کلیه مراحل در کیت مورد استفاده مطابق با دستورالعمل شرکت سازنده و در روش­ها بر اساس منابع ذکر شده انجام گرفت. در ادامه کیفیت و کمیت RNA به‌دست آمده بررسی گردید.

برای تعیین کیفیت RNAی استخراج ‌شده عمل الکتروفورز به دو روش ژل آگارز و ژل فرم‌آلدئید-آگارز انجام گرفت که در الکتروفورز با ژل آگارز از ژل یک درصد و بافر (0.5X)  TBEو یا TAE (1X) برای بافر تانک و ژل استفاده شد. سپس 4 میکرولیتر‌‌ از نمونه RNAی استخراج شده با 2 میکرولیتر‌‌ از لودینگ بافر (Loading Buffer) مخلوط شده، درون چاهک‌های ژل ریخته شد. الکتروفورز در ولتاژ ثابت 80 ولت و به مدت 15 دقیقه انجام گردید.

از آنجایی‌که RNA به سرعت توسط آنزیم RNase موجود در محیط تجزیه می‌شود، در الکتروفورز RNA با استفاده از ژل فرم‌آلدئید-آگارز، معمولاً‌ از آب مقطر تیمار‌ شده با DEPC و بافر MOPS استفاده می‌گردد. در این روش، از ژل آگارز یک درصد و بافر MOPS (1X) استفاده شد. در ادامه، پس از آماده شدن ژل، همانند ژل آگارز، نمونه‌های RNA درون چاهک‌های ایجاد شده در ژل فرم‌آلدئید-آگارز اضافه گردید. سنجش کمیت RNA استخراج شده با بررسی جذب نوری در طول موج‌ 260 نانومتر و با استفاده از فرمول " فاکتور رقت × A260 × 40" به صورت میکروگرم بر میلی‌لیتر محاسبه گردید. پس از استخراج RNA کل و برای حصول اطمینان از نبودن DNA ژنومی، نمونه­های RNA با استفاده از آنزیم DNase تیمار گردیدند و سپس برای ساخت cDNA از آن استفاده گردید.

برای ساختن cDNA از دستورالعمل کیت
Revert AidTM First Strand cDNA Synthesis شرکت فرمنتاز استفاده گردید. ساخت cDNA با استفاده از آغازگر الیگو (dT)18 انجام گرفت. از آنجایی‌که حضور ژن mnp در قارچ‌های خوراکی مختلف شناسایی و توالی آن در برخی از گونه‌های شبیه قارچ خوراکی دکمه‌ای
(A. bisporus) تعیین شده بود، در واکنش‌های RT-PCR از آغازگرهای استفاده شده توسط Lankinen و همکاران (2005) با کمی تغییرات در تعداد و توالی نوکلئوتیدها استفاده شد. توالی آغازگرهای بهینه شده به صورت زیر است:

آغازگر رفت: 

5`ATGGCTTTCAAAATTCTTCTCA 3`

 آغازگر برگشت:

5`TCAGAGGTGGGAACTGGC 3`

 

برنامه حرارتی واکنش زنجیره­ای پلیمراز با استفاده از آنزیمTaq پلیمراز به صورت، چرخه نخست: 3 دقیقه در دمای °C 94، 35 چرخه بعدی: °C 94 به مدت 45 ثانیه، °C60 به مدت 50 ثانیه و °C 72 به مدت 2 دقیقه و چرخه نهایی: °C 72 به مدت 5 دقیقه انجام گرفت. مخلوط استفاده شده در واکنش PCR در جدول 1 مشخص شده است.

محصولات واکنش PCR در دمای °C 4 و در یخچال نگهداری شدند. برای مشاهده و بررسی محصولات تکثیر شده، از الکتروفورز ژل آگارز 1 درصد و بافر TAE (TBE) با ولتاژ ثابت 80 ولت استفاده شد و رنگ‌آمیزی ژل با استفاده از اتیدیوم بروماید صورت گرفت. پس از الکتروفورز محصولات PCR همراه با سایز مارکر Lambda DNA/EcoRI+ Hind III، با استفاده از دستگاه UV-ترانسلومیناتور باند مربوطه مشاهده و اندازه آن تخمین زده شد. قطعه تکثیر‌‌شده ژن mnp با استفاده از دستورالعمل کیت خالص‌‌سازی DNA از ژل شرکت
(K-3035-1) Bioneer جدا و خالص­سازی گردید.


 

جدول 1- اجزای مخلوط واکنش PCR

موارد مورد نیاز

مقدار مصرف در

هر واکنش (μl)

غلظت نهایی

(در حجم μl25)

بافر PCR ( X10)

5/2

 X       1

کلرید منیزیم (mM 50)

25/1

 mM1

دزوکسی نوکلئوتید تری فسفات (mM 10)

5/0

 mM2/0 هر نوکلئوتید

آغاز گر رفت (pmol/µl 10)

1

       pmol/µl4/0

آغاز گر برگشت (pmol/µl 10)

1

       pmol/µl4/0

cDNA الگو

5

-

DNA پلیمراز Taq  ( U/µl5)

3/0

lµ25U/ 5/1

آب مقطر دیونیزه استریل

45/13

-

 

 

 

 

 

 

 

 

 

 

 

همسانه‌‌سازی ژن mnp  با استفاده ازInsT/AcloneTM PCR Product Cloning Kit به شماره کاتالوگ K1214 انجام شد. باکتری مورد استفاده اشرشیاکولی از نژاد DH5α بود. مراحل انجام همسانه­سازی به این ترتیب بود:

در مرحله اتصال، T/A وکتور مورد استفاده pTZ57R/T با اندازه 2886 جفت باز بود (شکل 1). نسبت DNAهای مورد استفاده از 1:1 تا 1:6 (DNA مورد نظر: وکتور) متغیر بود. در ادامه، با استفاده از دستورالعمل Maniatis و همکاران (1989) با اعمال تغییراتی ژن mnp تکثیر شده به باکتری‌ اشرشیاکولی نژاد DH5α وارد شد. بعد از 16 ساعت از کشت سلول‌های مستعد‌ شده بر روی پلیت محیط‌کشت LB حاوی آنتی بیوتیک پنی­سیلین، کلنی‌های کوچکی نمایان شدند. در این مرحله، کلونی‌های سفید باکتری‌های نوترکیب به محیط کشت مایع انتقال داده و به آنها اجازه داده شد تا رشد کرده، به OD حدود 7/0 برسد. سپس با استفاده از دستورالعمل Maniatis و همکاران (1989) اقدام به استخراج پلاسمید از باکتری‌های نوترکیب برای تأیید ترانسفورماسیون گردید.

 

 

 

شکل 1- نقشه هضم آنزیمی در ناقل pTZ57R/T

 

جدول 2- ترکیبات هضم آنزیمی

ترکیبات

هضم با آنزیم (lµ) Hind III

هضم با آنزیم (lµ) kpn I

هضم مضاعف(lµ)

آنزیم (Hind III)

1

-

1

آنزیم (kpn I)

-

1

1

DNA (پلاسمید+ ژن mnp)

5

5

5

بافر Tango (X10)

2

2

2

آب

12

12

11

کل

20

20

20

 

 

برای تأیید اندازه پلاسمید نوترکیب، نخست پلاسمید به صورت خطی درآمد. برای این منظور، پلاسمید نوترکیب با آنزیمی که تنها دارای یک سایت برشی در پلاسمید نوترکیب است، برش داده شد. آنزیم انتخاب شده Hind III بود که هیچ‌‌گونه سایت برشی در ژنmnp  نداشته، تنها دارای یک سایت برشی در پلاسمید pTZ57R/T است. برای تأیید الگوی هضمی پلاسمید استخراج شده با الگوی هضمی پلاسمید نوترکیب مورد انتظار ( بر اساس توالی
mnp+ pTZ57R/T)، از هضم مضاعف با آنزیم‌های Hind III و kpn I که کل ژن را از ناقل جدا می‌کنند، استفاده شد (جدول 2). از الکتروفورز ژل آگارز 1 درصد برای بررسی نتایج هضم استفاده گردید. در مرحله آخر، برای تأیید نهایی این که قطعه وارد شده به پلاسمید همان ژن mnpاست، پلاسمید نوترکیب برای تعیین توالی فرستاده شد.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 


نتیجه‌گیری و بحث

نسبت  A260/A280در نمونه‌های استخراج‌شده، با استفاده از سه روش گوانیدین تیوسانات-فنل-کلروفرم (AGPC)، مبتنی بر کلرید لیتیم و کیت تجاری
RNA-X plus به ترتیب، 1±2 ،1±4/1 و 1±9/1 بود (جدول 3). وضوح و شدت باندهایSrRNA28 و SrRNA18 در RNA استخراج‌ شده بر روی ژل آگارز و یا فرم آلدئید-آگارز نشان‌دهنده کیفیت RNA استخراج‌شده است (شکل 2). کیفیت این باندها مطابق با شکل 1 در روش‌های گوانیدین تیوسانات-فنل-کلروفرم و کیت تجاری RNA-X plus به مراتب بهتر از روش مبتنی بر کلرید لیتیم بود. بهترین نسبت برای A260/A280 در مورد RNA عددی بین 8/1 تا 2 است که نسبت‌های بیشتر از 2 و کمتر از 8/1 نشان‌دهنده آلودگی‌های فنلی و پروتئینی هستند. بر این اساس، در روش مبتنی بر کلرید لیتیم، بیشترین میزان ناخالصی‌های پروتئینی دیده می‌شود، اما روش‌های گوانیدین تیوسیانات-فنل-کلروفرم و کیت تجاری RNA-X plus سیناژن از نظر عملکرد و کیفیت RNA حاصله برتر از روش­ اول هستند (جدول 3).


 

جدول 3- عملکرد RNA‌ و نسبت A260/A280 در سه روش AGPC، روش مبتنی بر کلرید لیتیم و کیت تجاری RNA-X plus

روش جداسازی RNA

عملکرد RNA (µg/ml)

A260/A280

AGPC

3±22

1±2

روش مبتنی بر کلرید لیتیم

2±17

1±4/1

کیت تجاری RNA-X plus سیناژن

6±54

1±9/1

 

٭هر یک واحد از A260 معادل با µg/ml40 ملکول  RNAبرآورد شده است.

 

 

شکل 2- RNA کل استخراج ‌شده بر روی ژل فرم آلدئید-آگارز (1%)

RNA 1  استخراج شده با دستورالعمل Sacchi (1987) Chomszynski and .

RNA 2  استخراج‌شده با دستورالعمل Sreenivasaprasad (2000).

RNA 3  استخراج شده به‌وسیله کیت تجاری RNA-X plus.

M سایز مارکر DNA (bp 100).

 

 

 

 

 

 

 

 

 

 

از آنجایی‌که هدف تکثیر یک قطعه اختصاصی با استفاده از واکنش زنجیره‌ای پلیمراز بود، RNA استخراج شده مستقیماً برای تهیه cDNA استفاده گردید. اندازه قطعه تکثیر شده توسط PCR با مراجعه به بانک­­های اطلاعاتی (NCBI، expasy و ebi) حدود 1065 جفت باز گزارش شده است. با اینکه برای تکثیر از آغازگرهای اختصاصی استفاده می­شد و انتظار مشاهده تک‌باند بر روی ژل آگارز می­رفت، اما برای حذف مواد زائد به ‌جای مانده از PCR و همچنین آغازگرهای استفاده نشده، قطعه bp 1065 از روی ژل آگارز 1% با استفاده از کیت تجاری خالص‌‌سازی ژل شرکت(K-3035-1)   Bioneerجدا‌سازی شد. تکرار عمل الکتروفورز بر روی نمونه خالص‌شده از روی ژل، کیفیت و مقدار قطعه جدا شده را برای انجام فرایند توالی‌یابی تأیید کرد (شکل 3).

 

 

 

شکل 3- تکثیر ژن mnp با استفاده از آنزیم پلیمراز Taqبر روی ژل آگارز 1%

-1 محصول PCR با بهینه­سازی چرخه­های دمایی

-2 PCR خالص­سازی شده با استفاده از کیت تجاری خالص­سازی DNA از ژل (Bioneer)

-M1 سایز مارکر bp100

-M2 سایز مارکرbp 50

 

 

پس از انجام ترانسفورماسیون و کشت باکتری‌های ترانسفورم ‌شده بر روی محیط کشت LB حاوی آنتی‌بیوتیک آمپی­سیلین، X-Gal و IPTG و 16 ساعت انکوباسیون در دمای C◦37، کلونی­های آبی و سفید ظاهر گردیدند (شکل4-6). برای انجام عمل اتصال (Ligation) مقدار DNA به ناقل با نسبت­های 3، 5 و 7 استفاده شد. محصول اتصال حاصل از نسبت  7 به 1 (DNA به ناقل)  بهترین نتیجه را به واکنش اتصال داد و کلونی­های سفید رنگ که نشان‌دهنده ورود ژن به پلاسمید (در سیستم تشخیص سفید/آبی) است، در این نسبت بیشترین میزان را شامل می­شد.

استخراج پلاسمید از تمام کلونی­های سفید انجام شد، اما در شکل 4 قسمت (الف)، تنها در یکی از کلونی‌های انتخاب شده پلاسمید تراریخته وجود داشت. اسمیر انتهای ژل نیز نمایانگر آلودگی­های پروتئینی به‌جا مانده از استخراج پلاسمید است (شکل 3- الف). پس از هضم پلاسمیدها، برش‌های منفرد و مضاعف به‌وسیله آنزیم‌های برشی Hind III و Kpn I انجام گرفت. در برش‌های منفرد، با توجه به اندازه پلاسمید خطی بدون قطعه وارد‌شده که حدود bp 2886 است (شکل 3-ب، چاهک 1)، باند پلاسمید مشاهده‌ شده در صورت داشتن قطعه ژن mnp باید اندازه­ای معادل bp 3951=1065+2886 مشاهده گردد. باند مذکور در شکل 3 قسمت ب در چاهک شماره 3 مشاهده می­شود. برش مضاعف پلاسمید دارای قطعه موردنظر نیز باعث جدایی ژن mnp از پلاسمید شده، این قطعه را به صورت باندی جداگانه قابل مشاهده کرد (شکل 3- ب، چاهک 4). الگوی هضم پلاسمید حلقوی و خطی شده بدون قطعه مورد ‌نظر که به‌عنوان شاهد استفاده شده بود، صحت آزمایش‌های و ورود قطعه ژن mnpرا در پلاسمید تأیید کرد.

 

توالی­یابی و اطلاعات ملکولی تکمیلی

قطعه ویرایش‌شده نهایی، در بانک اطلاعاتی NCBI برای بررسی همولوژی آن در میان موجودات دیگر بررسی شد. نتایج این بررسی‌ها نشان داد، که قطعه توالی‌یابی شده در بین بسیاری از موجودات مختلف، از جمله: باکتری‌ها، قارچ‌ها و گیاهان دارای قسمت‌های مشابهی است. میزان این تشابه در موجوداتی، مانند برخی از قارچ‌ها و باکتری‌ها بسیار زیاد بود. بر‌اساس اطلاعات دریافت ‌شده از سایت www.ebi.ac.uk آنزیم منگنز پراکسیداز (MnP) جزو خانواده پراکسیدازهای گیاهی و زیر مجموعه لیگنینازها طبقه‌بندی شده است.

 

 

 

 

شکل 3 الف) هضم پلاسمید دارای ژن همسانه‌شده (1- پلاسمید خطی شده pTZ57R/T، 2- پلاسمید طبیعی pTZ57R/T؛ 3- پلاسمید نوترکیب حاوی قطعه خارجی؛ 4- هضم مضاعف پلاسمید نوترکیب یا استفاده از آنزیم‌های Hind IIIو kpn I؛ 5- ژن mnp پس از خالص‌سازی از ژل، M- مارکر وزن ملکولی DNA  (kb 1))

ب) استخراج پلاسمید با روش Maniatis و همکاران (1989) (:1, 2, 3, 4, 5, 6, 7, 9, 10, 11 نمونه‌های پلاسمید فاقد قطعه خارجی (ژن مورد‌نظر)، 8- پلاسمید نوترکیب، M- مارکر وزن ملکولی DNA  (kb 1))

 

 

 

 

 

 

 

 

 

 

پس از تعیین ترتیب صحیح نوکلئوتیدها در توالی شناسایی‌شده و بررسی منحنی‌های حاصل از توالی‌یابی ژن mnp در قارچ خوراکی دکمه‌ای (A. bisporus)، مشابه‌ترین توالی موجود در بانک اطلاعاتی NCBI، با استفاده از نوکلئوتید بلاست بررسی شد. توالی شناسایی‌شده با مورد موجود در بانک اطلاعاتی NCBI تطبیق داده شد و مشخص گردید که بجز نوکلئوتیدهای 657 و 850 در بقیه نوکلئوتیدها مشابه هستند. ویژگی‌ها و توالی رشته پلی‌پپتیدی حاصل از توالی دو رشته مشابه با استفاده از سایت‌www.expasy.org/tools  تعیین گردید (شکل 6). ژن mnp1 به‌عنوان ژن ثبت شده و توالی mnp به‌عنوان ژن توالی­یابی شده بیان می‌شود.

mnp1: Theoretical pI/Mw: 4.18 / 37636.22

mnp:   Theoretical pI/Mw: 4.33 / 32686.23

 

بر ‌اساس اطلاعات مندرج در سایت www.ebi.ac.uk، آنزیم منگنز پراکسیداز (EC 1.11.1.13) به نام‌های دیگری

Mn-dependent (NADH-oxidizing) peroxidase,

Peroxidase-M2 and Mn-dependent peroxidase

 نیز شناخته می‌شود. همچنین، این آنزیم به کوفاکتور آهن نیز برای انجام فعالیت‌های خود نیازمند است. در سایت مذکور و در قسمت مربوط به توضیحات آنزیم منگنز پراکسیداز آورده شده است که این آنزیم یک همو پروتئین است که توسط قارچ‌های بازیدیومایست تولید ‌شده، توانایی تجزیه ترکیبات لیگنینی را دارد.

با توجه به نتایج حاصله در multiple alignment نوکلئوتیدی مبنی بر اینکه در توالی­های مشابه در گونه­های نزدیک به A. bispous، در این دو مکان نوکلئوتیدی متفاوت بوده و در نتایج multiple alignment پروتئینی توالی­های مشابه در گونه­های نزدیک به A. bispous، تغییر در نوکلئوتیدهای 657 و 850، به ترتیب باعث تبدیل اسیدآمینه­های ایزولوسین و سرین به والین و آلانین شده است، می­توان حدس زد که این توالی آمینواسیدی ژن mnp، توالی ثانویه برای آنزیم منگنز پراکسیداز گونه
A. bispous (دارای دو موتاسیون نقطه­ای) باشد. این احتمال وجود دارد که این موتاسیون نتیجه به کارگیری از نژاد IM008 اصلاح شده در جهاد دانشگاهی مشهد باشد، اما این موضوع در حد یک احتمال بوده، باید مورد تحقیقات بیشتری قرار گیرد.

 
 

فارسی، م. و گردان، ح. ر. (1386) پرورش و اصلاح قارچ­های خوراکی با تأکید بر قارچ خوراکی دکمه­ای سفید، انتشارات جهاد دانشگاهی مشهد، مشهد، ایران.

قربانی­فعال، پ.، فارسی، م.، پوریان­فر، ح. ر.، محمودنیا میمند، م. و ذوالعلی، ج. (1387) تهیه شناسنامه ملکولی برای 12 نژاد قارچ خوراکی دکمه‌ای Agaricus bisporus با استفاده از نشانگرهای AFLP، مجله حفاظت گیاهان (علوم و صنایع کشاورزی) 67- 58 :22.

 

 

 

Chen, D. M., Taylor, A. F. S., Burke, R. M., and Cairney, J. W. G. (2001) Identification of genes for lignin peroxidases and manganese peroxidases in ectomycorrhizal fungi. New Phytologist 152:151-158.

Chomszynski, P. and Sacchi, N. (1987) Single-step method of RNA isolation by acid Guanidinium Thiocyanate-Phenol-Chloroform extraction. Analytical Biochemistry 162:156-159.

Heinzkill, M., Bech, L., Halkier, T., Schneider, P., and Anke, T. (1998) Characterization of laccases and peroxidases from wood-rotting fungi (family Coprinaceae). Applied and Environmental Microbiology 64: 1601-1606.

Hofrichter, M. (2002) Review: lignin conversion by manganese peroxidase (MnP). Enzyme and Microbial Technology 30: 454-466.

Irie, T., Honda, Y., Watanabe, T. and Kuwahara, M. (2001) Homologous expression of recombinant manganese peroxidase genes in ligninolytic fungus Pleurotus ostreatus. Applied and Environmental Microbiology 55: 566-570.

Kamitsuji, H., Honda, Y. Watanabe, T. and Kuwahara, M. (2004) Production and induction of manganese peroxidase isozymes ina white-rot fungus Pleurotus ostreatus. Apply Microbiology and Biotechnology 65: 287-294.

Lankinen, P., Hilden, K., Aro, N., Salkinoja-salonen, M. and Hatakka, A. (2005) Mangnese peroxidase of Agaricus bisporus: grain bran-promoted production and gene characterization, Apply Microbiology and Biotechnology 66: 401-407.

Lankinen, V. P., Bonnen, A. M., Anton, L. H., Wood, D. A., Kalkkinen, N., Hatakka, A., and Thurston, C. F. (2001) Characteristics and N-terminal amino acid sequence of manganese peroxidase from solid substrate cultures of Agaricus bisporus. Applied and Environmental Microbiology 55: 170-176.

Ma, B., Mayfield, M. B., Godfrey, B. J. and Gold, M. H. (2004) Novel promoter sequence reguired for manganese requlation of manganese peroxidase isozyme 1 gene expression in Phanerochaete chrysosporium. Eukaryotic Cell 3: 579-588.

Maniatis, T., Fritsch, E. F. and Sambrook, J. (1989) Molecular cloning: a laboratory manual. 2ndEd, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.

Moloy, S. (2004) Sugar transport and water relations of Agaricus bisporus. Ph.D Thesis, Cranfield University, United Kingdom.

Nagai, M., Sakamoto, Y. and Nakade, K. (2007) Isolation and characterization of the gene encoding a manganese peroxidase from Lentinula edodes. Mycoscience 48: 125-130.

Sreenivasaprasad, S. (2000) Isolation of fungal nucleic acids. In: The nucleic acid protocols handbook (ed. Rapley, R.), Humana Press, New Jersey.

Tagger, S., Perissol, C., Gil, G., Vogt, G., and Le Petit, J. (1998) Phenoloxidases of the white-rot fungus Marasmius quercophilus isolated from an evergreen oak litter (Quercusilex L.). Enzyme and Microbial Technology 23: 372-379.