مطالعه ژن عامل رونویسی متصل‌شونده به عناصر پاسخ‌دهنده به تنش کم آبی در برخی ارقام گندم نان ایران

نویسندگان

1 بخش زیست‌شناسی، دانشکده علوم، دانشگاه شیراز، شیراز، ایران

2 بخش زیست‌شناسی، دانشکده علوم، دانشگاه شیراز، شیراز، ایران بخش زیست فناوری، دانشکده علوم و فناوری‌های نوین، دانشگاه اصفهان، اصفهان، ایران

چکیده

پروتئین عامل رونویسی متصل‌شونده به عناصر پاسخ‌دهنده به تنش کم آبی، یکی از عوامل مهم رونویسی است که در بسیاری از گیاهان نقش کلیدی را در تحمل‌پذیری به تنش‌های محیطی ایفا می‌کند و تنها ویژۀ عالم گیاهی است. تنش اسمزی از قبیل خشکی، شوری و سرما، یکی از مهم‌ترین تنش‌هاست. این پروتئین به عناصر پاسخ‌دهنده به تنش‌های اسمزی متصل شده، باعث بیان چندین ژن می‌شود که در نهایت با اعمال تغییرات بیوشیمیایی و فیزیولوژیک باعث ارائه پاسخ مناسب به تنش محیطیِ اعمال شده می‌شود. خصوصیت اصلی این ژن، داشتن توالی حفاظت شده با نام ناحیه AP2 است که محصول آن به صورت پروتئین، به توالی خاصی از DNA متصل می‌شود. جداسازی و تعیین خصوصیات قسمتی از ژن این عامل مهم رونویسی از ارقام گندم نان امید، سرداری و زرین که بومی یا کشت‌شونده در ایران بوده، به ترتیب نیمه حساس، مقاوم و نیمه مقاوم به سرما هستند، صورت گرفت. استخراج DNA و mRNA، ساخت cDNA، طراحی پرایمرهای اختصاصی، PCR، الکتروفورز، عبور از ستون به منظور خالص‌سازی نمونه‌ها و تعیین توالی DNA، به شناسایی توالی‌های این ژن در ارقام مذکور منجر شد. تجزیه و تحلیل‌های مختلف بیو‌انفورماتیک نشان داد که آن‌ها دارای ناحیه AP2 بوده و متعلق به زیر خانواده عامل رونویسی متصل‌شونده به عناصر پاسخ‌دهنده به تنش کم آبی متعلق هستند. این توالی‌ها با شماره‌های دسترسی FC556848، FC556849 و FC55685 در بانک جهانی ژن (NCBI) به ثبت رسید.

کلیدواژه‌ها


عنوان مقاله [English]

Study of dehydration-responsive element binding-factor gene in some Iranian bread wheat cultivars

نویسندگان [English]

  • Sasan Mohsenzadeh 1
  • Javad Karimi Andeani 2
  • Hassan Mohabatkar 2
1 Department of Biology, Faculty of Sciences, University of Shiraz, Shiraz, Iran
2 Department of Biology, Faculty of Sciences, University of Shiraz, Shiraz, Iran Department of Biotechnology, Faculty of Advanced Sciences and Technologies, University of Isfahan, Isfahan, Iran
چکیده [English]

Dehydration-responsive element binding-factor (DREB) protein is one of the transcription factors which play a key role in tolerance to environmental stresses in many plants. Drought, salinity and cold are examples of important osmotic stresses. DREB binds to stress responsive elements causing over expression of several genes and ultimately biochemical and physiological modification gives appropriate response to the related stress. The main property of DREB gene is AP2 domain a conserved sequence that its protein product binds to a specific sequence of DNA. In this research, isolation and characterization of DREB gene from some native or cultivated Iranian bread wheat were studied. These cultivars named Omid, Sardari and Zarrin were semi sensitive, resistant, and semi resistant to cold stress respectively. DNA and mRNA extraction, cDNA synthesis, specific primer design, PCR, Electrophoresis, column purification and DNA sequencing, led to identify the sequences of this gene in three cultivars. Different bioinformatics analyses of the sequences showed that they had AP2 domain and belonged to DREB subfamily. These sequences were submitted to NCBI GenBank, and were recorded as FC556848, FC556849, and FC556851 accession numbers.

کلیدواژه‌ها [English]

  • Gene isolation
  • Transcription factor
  • Omid wheat
  • Sardari wheat
  • Zarrin wheat
  • AP2 domain

 

عوامل محیطی بر روی رشد و نمو گیاهان اثر فراوانی دارند. شناسایی مکانیسم‌های مولکولی در تحمل‌پذیری گیاهان به تنش‌های محیطی برای گیاهان زراعی دارای اهمیت اقتصادی است. سرما یکی از تنش‌های محیطی است که همه ساله خسارات قابل توجهی را به گیاهان زراعی وارد می‌کند. سرما به عنوان یک تنش اسمزی، جذب آب از ریشه گیاه را محدود کرده، باعث افت پتانسیل آب و انتقال آب از سیمپلاست به آپوپلاست می‌شود و در نتیجه کم آبی شدیدی را به دنبال خواهد داشت. سازش‌پذیری گیاه به سرما حاصل تغییرات بیوشیمیایی و فیزیولوژیک متنوعی است که اساساً از تغییر در بیان تعدادی از ژن‌های مسؤول در تحمل‌پذیری به تنش سرما ناشی می‌شود (Thomashow, 1999). از جمله ژن‌های تنظیمی درگیر در پاسخ به تنش‌ها، عوامل رونویسی هستند که نقش مهمی را در پاسخ به تنش در گیاهان ایفا می‌کنند. یکی از مهم‌ترین آنها پروتئین DREB
(Dehydration Responsive Element Binding) است که اعضای آن نقش اصلی را در تنش‌های غیر زیستی چون خشکی، شوری و سرما دارند و در گیاهان مختلفی، مانند آرابیدوپسیس، جو، برنج، گوجه‌فرنگی، آفتابگردان و غیره شناسایی شده‌اند (Liu et al., 2000; Sakuma et al., 2002; Agarwal et al., 2006; Xiong and Fei, 2006; Badawi et al., 2007).
عامل رونویسی DREB توالی‌ها یا عناصر خاصی به نام DRE (Dehydration Response Element) را روی پروموتر ژن‌های القا‌ شونده توسط تنش اسمزی شناسایی می‌کند. خانواده DREB پروتئین‌های مخصوص گیاهی هستند که دارای یک ناحیه بسیار حفاظت‌شده شامل 60 تا 70 اسید آمینه هستند که ناحیه AP2 (Apetala 2) نام دارند (Shen et al., 2003). تاریخ شناسایی DREB به آزمایشی که بر روی آرابیدوپسیس انجام شد، بر می‌گردد. دو cDNA مختلف DREB1A و DREB2A کلون شد و مشاهدات بعدی نشان داد که ژن کد کننده پروتئینی DREB1A و دو همولوگ آن B) و (C تحت تنش سرما و ژن کد کننده پروتئینی DREB2A و همولوگ آن (B) تحت تنش‌های خشکی و شوری القا می‌شوند (Liu et al., 1998). همچنین با مطالعه آرابیدوپسیس تراریخت، عملکرد محصولات این ژن‌ها را ارزیابی کردند و دریافتند که پروتئین‌های مذکور هر چند که ناحیه AP2 مشابهی دارند، ولی مسیرهای متفاوتی را تحت این تنش‌ها در القای ژن ها دارند. خصوصیات توالی DRE و توالی حفاظت شده ناحیه AP2 در آرابیدوپسیس بررسی شده است(Sakuma et al., 2002).

نتایج تحقیقات نشان داد مسیرهای القای مقاومت در تنش‌های خشکی، شوری، سرما و حتی ABA در عین جدا بودن، برهمکنش‌های بسیاری با هم دارند و ممکن است افزایش مقاومت به یک تنش سبب القای مقاومت به تنش‌های دیگر شود (Thomashow, 1999; Kasuga et al., 1999; Liu et al., 2000; Fowler and Thomashow, 2002). تنش‌های غیر زیستی مختلف نظیر خشکی، شوری و سرما گرچه به شکل‌های مختلف اعمال می‌شوند، ولی همگی اثر مشابهی بر میزان آب گیاه دارند. در اثر این تنش‌ها آب سلول‌های گیاهی از دست رفته، فشار تورژسانس آنها کاهش می‌یابد و همه این تنش‌ها نوعی تنش اسمزی محسوب می‌شوند (Sakuma et al., 2002). با توجه به اینکه پهنه وسیعی از حاصلخیزترین مناطق تولیدی و قسمت عمده محصولات اقتصادی مهم کشور، از جمله گندم همه ساله در معرض تهدید تنش‌های محیطی است که آثار نامطلوبی بر تولید و کیفیت محصولات کشاورزی دارد، پیشرفت در زمینه ایجاد مقاومت به این تنش‌ها مخصوصاً در گیاهان غله‌ای یکی از اهداف مهم کشاورزی است.

گندم نان امید، توده بومی ایران و نیمه حساس به تنش خشکی و سرماست. این رقم کیفیت نانوایی متوسط تا خوب دارد و در اکثر مناطق کشور کاشته می‌شود. گندم نان سرداری، بومی ایران و منطقه کردستان و مقاوم به سرماست. این رقم گندم کیفیت نانوایی ضعیفی دارد و بیشتر در مناطق دیم کوهستانی کشور کشت می‌شود. گندم نان زرین، غیر بومی است و نیمه مقاوم به تنش سرماست اما کیفیت نانوایی بسیار عالی دارد و در اکثر مناطق کشور که سرمای ملایمی دارد، کشت می‌شود. در این پژوهش از سه رقم گندم مقاوم، نیمه مقاوم و نیمه حساس به سرما، ژن عامل نسخه‌برداری DREB جداسازی و تعیین خصوصیات شد. هدف اساسی از این پژوهش، جداسازی و تعیین خصوصیت ژن DREB از ارقام گندم نان ایرانی به منظور شناخت مکانیسم‌های تحمل‌پذیری این گیاهان به تنش سرما و برسی امکان انتقال این ژن به گیاهان این خانواده و یا دیگر گیاهان زراعی حساس و همچنین شناسایی ژرم‌پلاسم ارقام ایرانی بود.

 

مواد و روشها

بذر سه رقم گندم نان نیمه حساس، مقاوم و نیمه مقاوم به تنش سرما به ترتیب به نام‌های امید، سرداری و زرین از بانک ژن گیاهی ایران واقع در کرج تهیه شد. این بذرها ابتدا با محلول هیپوکلریت سدیم 5 درصد به مدت 10 دقیقه ضد عفونی و سپس در گلدان‌های مجزا کاشته شد. نمونه‌ها در اتاقک کشت با شرایط طول روز 16 ساعت، طول شب 8 ساعت، دمای روز 22 درجه سانتیگراد، دمای شب 15 درجه سانتیگراد، رطوبت 60 درصد قرار داده شدند. برای القا تنش سرما، گیاهچه‌های 16 روزه به مدت یک هفته و هر روز 5 ساعت در دمای 4 درجه سانتیگراد در یخچال گذارده شدند.

جداسازی و تعیین خصوصیات عامل رونویسی DREB در ارقام گندم شامل استخراج DNA، طراحی آغازگرهای اختصاصی، PCR، ژل الکتروفورز، عبور از ستون به منظور خالص‌سازی محصول PCR، تعیین توالی DNAو تجزیه و تحلیل‌های بیوانفورماتیک و تأیید ناحیه AP2 با نرم‌افزارهایی همچون BLAST، ProDom، PROSITE، SMART، CDD، CDART، BLOCKS و Pfam و ثبت توالی‌ها‌ در بانک جهانی ژن بود. استخراج DNA با روش CTAB تغییر یافته (Sumer et al., 2003) و از برگ گیاهچه‌های
16 روزه گندم صورت گرفت. با بهره‌گیری از نرم‌افزار الیگو 5 و هم‌آرایی توالی‌های مشابه ثبت شده در بانک جهانی ژن (NCBI) یک جفت آغازگر مناسب ژن DREB به قرار زیر طراحی و توسط شرکت آلمانی MWG ساخته شد: توالی پیشرو:

5´-TATGGATTGCCTTGATGAACA-3´

و توالی برگشت:

5′-GACTCCGATTCATCCTTCCC-3′

برنامه زمانی و دمایی واکنش PCR به صورت دمای اولیه 94 درجه سانتیگراد به مدت 5 دقیقه و سپس 35 سیکل به صورت 94، 53 و 72 درجه سانتیگراد هر کدام به مدت 1 دقیقه و دمای نهایی 72 درجه سانتیگراد به مدت 10 دقیقه تنظیم شد.

پرایمرهای اکتین مورد استفاده برگرفته از مقاله پژوهشی Pellegrineschi و همکاران (2004) و از این قرار بود، توالی پیشرو:

5'- GACCCAGACAACTCGCAACT -3'

و توالی برگشت:

5'-CTCGCATATGTGGCTCTTGA -3'

برنامه زمانی و دمایی واکنش PCR به صورت فوق بود.

برای استخراج RNA از کیت مخصوص
Bio-RAD (Aurum Total RNA Mini Kit, USA) استفاده شد. در این کیت از آنزیم DNase به منظور عدم آلودگی نمونه RNA به DNA ژنومی استفاده گردید. سپس اولین رشته cDNA از روی mRNA فاقد DNA ژنومی با کیت Roche ساخته شد که از روی آن رشته مکمل در اولین دور واکنش PCR سنتز می‌شود. از ژن اکتین نیز برای سنجش صحت انجام RT-PCR استفاده گردید. پس از انجام PCR نمونه‌ها بر روی ژل آگاروز 1 درصد الکتروفورز شدند. به منظور خالص‌سازی محصول PCR و آماده کردن آن برای تعیین توالی از کیت شرکت Roche
(High Pure PCR Product Purification Kit, Germany) استفاده شد و سپس توسط شرکت MWG آلمان تعیین توالی گردید.

 

نتایج و بحث

توالی ژن DREB گندم یا TADREB که در این پژوهش از دو منبع ژنومی و cDNA در سه نوع گندم امید، زرین و سرداری به دست آمد، در واقع قسمتی از ژن کامل است که طولی بین 436 تا 438 جفت نوکلئوتید دارد. برای اطمینان از استخراج mRNA و ساخت درست cDNA، محصول واکنش با آغازگر ژن اکتین که همیشه در سلول‌های گیاهی بیان می‌شود PCR و الکتروفورز شد. شکل 1 ژل الکتروفورز محصول PCR با نواری به طول حدود 500 جفت نوکلئوتید مربوط به cDNA سه نوع گندم با آغازگر اکتین را نشان می‌دهد. شکل 2، ژل الکتروفورز محصول PCR سه رقم گندم امید، سرداری و زرین از دو منبع ژنومی و cDNA است. مقایسه ژل الکتروفورز این دو منبع نشان می‌دهد که TADREB به دست آمده از منبع ژنومی و cDNA هر سه نمونه گندم، در باندهایی با اندازه یکسان قرار گرفتند و مقایسه توالی آن‌ها نیز حاکی از شباهت 100 درصدی از نظر طول توالی‌ها بود که نشان می‌دهد ژن مورد نظر حداقل در طول قطعه جدا شده، فاقد اینترون بوده، طول و توالی DNA و cDNA مشابه دارد و دست کم در این محدوده از ژنوم، اینترونی وجود ندارد. آنالیز بیوانفورماتیک نیز این مورد را تأیید نمود. شکل 3، تجزیه و تحلیل‌های بیوانفورماتیکی از توالی اسید آمینه حاصل از ترجمه توالی ژن DREB به دست آمده از ارقام گندم مذکور را نشان می‌دهد. وجود ناحیه AP2 دومین اثبات نمود که ژن‌های مذکور از اعضای زیر خانواده مهم DREB هستند. شکل 4 نشان می‌دهد که ناحیه AP2 در توالی جداسازی شده حاوی 3 زنجیره
β-sheets و یک زنجیره α-helix است و اسید آمینه والین در موقعیت 14 و اسید آمینه گلوتامیک در موقعیت 19 آن قرار دارند که نقش مهمی در تشخیص توالی متصل‌شونده به DNA ایفا می‌کنند. توالی نوکلئوتید و آمینو اسید به دست آمده از
DREB cDNA گندم‌های نان مذکور نشان داد که این منطقه حاوی 3 زنجیره β-sheets و یک زنجیره
α-helix است که جایگاه هر قطعه دقیقاً در توالی مشخص شد. همچنین سایر قسمت‌های این ناحیه به لوپ‌های بینابینی مربوط می‌شود. با بررسی در بانک ژنی آرابیدوپسیس 145 ژن کد کننده پروتئین‌های دارای ناحیه AP2 یافته شد. بر این اساس 14 ژن دارای دو ناحیه AP2 و 131 ژن دارای یک ناحیه AP2 بودند که 56 ژن از آن، پروتئین‌های زیر خانواده DREB را کد می‌کنند (Sakuma et al., 2002). فرض بر این است که انتقال جانبی ژن‌های سیانو باکترها و ویروس‌ها از طریق پدیده همزیستی داخلی به گیاهان صورت گرفته و منشأ تشکیل خانواده بزرگ عوامل رونویسی دارای ناحیه AP2 شده است. سپس در گیاهان از طریق پدیده‌های مختلفی چون حذف یا اضافه شدن اینترون‌ها و اگزون‌ها و جابه‌جایی و یا طرق دیگر اعضای مختلف و زیر خانواده‌های گوناگون این خانواده بزرگ به وجود آمده‌اند (Magnaniet al., 2004).

هم ردیفی توالی‌های cDNA سه رقم گندم امید، زرین و سرداری نشان می‌دهد که شباهت زیادی با یکدیگر دارند. توالی‌ها با شماره‌های دسترسی FC556848، FC556849 و FC556851 در بانک جهانی ژن NCBI به ثبت رسید. مهندسی ژنتیک این ژن با توجه به اینکه عامل رونویسی DREB قادر است همزمان القای چندین ژن القا شونده در تنش را تحت تنظیم خود داشته باشد، اهمیت زیادی دارد. در روش‌های معمول انتقال ژن گیاهان تراریخت فراوانی معرفی شداند، ولی به دلیل انتقال تنها یک ژن، بهبود نسبی مشاهده شده است، امّا انتقال ژنDREB به دلیل اینکه تنظیم بیان چندین ژن را بر عهده دارد، می‌تواند آثار چند گانه داشته باشد (Dubouzet et al., 2003; Savitch et al., 2005). نتایج این پژوهش علاوه بر شناسایی ژرم‌پلاسم ایرانی به یافتن راه‌های القا مقاومت در ارقام پر بازده به منظور افزایش محصول و کاهش خسارات ناشی از تنش‌های محیطی حساس کمک می‌نماید.

 

 

شکل 1- ژل الکتروفورز محصول PCR مربوط به استخراج mRNA و ساخت درست cDNA با آغازگر اکتین.

1، 2 و 3 به ترتیب مربوط به گندم‌های نانامید، سرداری و زرین و M مارکر bp100 است.

 

 

 

شکل 2- ژل الکتروفورز محصول PCR سه رقم گندم از منبع cDNA (1، 2 و 3 به ترتیب مربوط به گندم‌های نانامید، سرداری و زرین) و از منبع DNA (4، 5 و 6 به ترتیب مربوط به گندم‌های نانامید، سرداری و زرین)، M مارکر bp100 است.

 

 

شکل 3- ناحیه AP2 در توالی اسید آمینه DREB جداسازی شده از این ارقام گندم با استفاده از نرم افزار CDD search

 

 

شکل 4- ساختار سه بعدی پروتئین از ناحیه AP2 از توالی اسید آمینه DREB جداسازی شده از این ارقام گندم با استفاده از نرم‌افزار Pfam

 

 

 
 

Agarwal, P. K. A. Agarwal, P. Reddy, M. K. and Sopory, S. K. (2006) Role of DREB transcription factors in abiotic and biotic stress tolerance in plants. Plant Cell Reports 25(12): 1263-1274.

Badawi, M., Danyluk, J., Boucho, B., Houde, M. and Sarhan, F. (2007) The CBF gene family in hexaploid wheat and its relationship to the phylogenetic complexity of cereal CBFs. Molecular Genetics and Genomics 277: 533-554.

Dubouzet, J. G., Sakuma, Y., Ito, Y., Kasuga, M., Dubouzet, E. G. and Miura, S. (2003) OsDREB genes in rice, Oryza sativa L. encode transcription activators that function in drought, high-salt- and cold-responsive gene expression. Plant Journal 33: 751-763.

Fowler, S. and Thomashow, M. F. (2002) Arabidopsis transcriptome profiling indicates that multiple regulatory pathways are activated during cold acclimation in addition to the CBF cold response pathway. Plant Cell 14: 1675-1690.

Kasuga, M., Liu, Q., Miura, S., Yamaguchi-Shinozaki, K. and Shinozaki, K. (1999) Improving plant drought, salt and freezing tolerance by gene transfer of a single stress-inducible transcription factor. Nature Biotechnology 17: 287-291.

Liu, Q., Kasuga, M., Sakuma, Y., Abe, H., Miura, S., Yamaguchi-Shinozaki, K. and Shinozaki, K. (1998) Two transcription factors, DREB1 and DREB2, with an EREBP/AP2 DNA binding domain separate two cellular signal transduction pathways in drought-and low-temperature-responsive gene expression, respectively, in Arabidopsis. Plant Cell 10: 1391–1406.

Liu, Q., Zhao, N., Yamaguch-Shinozaki, K. and Shinozaki, K. (2000) Regulatory role of DREB transcription factors in plant drought, salt and cold tolerance. Chinese Science Bulletin 45(11): 970-975.

Magnani, E., lander, K. and Hakea, S. (2004) From endonucleases to transcription factors: Evolution of the AP2 DNA binding domain in plants. Plant Cell 16: 2265-2277.

Pellegrineschi, A., Reynolds, M., Pacheco, M., Brito, R. M., Almeraya, R., Shinozaki, K. Y. and Hoisington, D. (2004) Stress-induced expression in wheat of the Arabidopsis thaliana DREB1A gene delays water stress symptoms under greenhouse conditions. Genome 47: 493-500.

Sakuma, Y., Liu, Q., Dubouzet, J. G., Abe, H., Shinozaki, K. and Yamaguchi-Shinozaki, K. (2002) DNA-binding specificity of the ERF/AP2 domain of ArabidopsisDREBs, transcription factors involved in dehydration and cold-inducible gene expression. Biochemical and Biophysical Research Communications290: 998-1009.

Savitch, l., Allard, G., Seki, M., Robert, L., Tinker, N., Huner, N. and Singh, K. (2005) The effect of overexpression of two Brassica CBF/DREB1-like transcription factors on photosynthetic capacity and freezing tolerance in Brassica napus Plant. Cell Physiology 46(9): 1525-1539.

Shen, Y. G., Zhang, W. K., Yan, D. Q., Du, B. X., Zhang, J. S. and Liu, Q. (2003) Characterization of a DRE-binding transcription factor from a halophyte Atriplex hortensis. Theoretical and Applied Genetics 107: 155-161.

Sumer, A., ahmet, D. and gulay, Y. (2003) Isolation of DNA for RAPD analysis from dry leaf material of some Herpes L. Specimens. Plant Molecular Biology Reporter 21: 461a-461f.

Thomashow, M. F. (1999) Plant cold acclimation: freezing tolerance genes and regulatory mechanisms. Annual Review of Plant Biology 50: 571-599.

Xiong, Y. and Fei, S. (2006) Functional and phylogenetic analysis of a DREB/CBF-like gene in perennial ryegrass (Lolium perenne L.) Planta 224: 878-888.