مطالعه فیزیولو‍ژیک و مولکولی مقاومت به شوری دو رقم دیپلویید و تتراپلویید پنبه

نویسندگان

گروه زیست‌شناسی، دانشکده علوم، دانشگاه گلستان، گرگان، ایران

چکیده

در این تحقیق، پاسخ‌های فیزیولوژیک و مولکولی دو رقم دیپلویید (قوزه‌درشت Gossypium herbaceum) و تتراپلویید (ساحل Gossypium hyrsutum) پنبه در شرایط تنش شوری بررسی شده است. پس از رشد، گیاهچه‌ها در 5 سطح شوری 0، 50، 75، 100 و 150 میلی‌مولار کلرید سدیم در شرایط گلخانه تیمار شدند. آزمایش به صورت طرح کاملاً تصادفی انجام یافت. نتایج نشان داد که تیمار شوری سبب کاهش طول هر دو رقم می‌شود. تیمار شوری سبب کاهش بیشتر محتوای کلروفیل a، b و کلروفیل کل در رقم قوزه‌درشت نسبت به رقم ساحل شد. همچنین، با تیمار شوری غلظت سدیم برگی در رقم قوزه‌درشت نسبت به رقم ساحل افزایش بیشتری یافت. بررسی فعالیت آنتی‌اکسیدان نشان داد که با تیمار شوری فعالیت دو آنزیم کاتالاز و پلی فنل اکسیداز در هر دو رقم کاهش معنی‌داری را نشان می‌دهد. بررسی فعالیت آنزیم پراکسیداز در تیمار شوری نشان داد که با افزایش غلظت نمک فعالیت این آنزیم در رقم ساحل به طور معنی‌داری افزایش یافت، در حالی که فعالیت این آنزیم در رقم قوزه‌درشت کاهش معنی‌داری را نشان داد. بررسی بیان ژن TPS1 در برگ و ریشه این دو رقم نشان داد که با تیمار شوری بیان این ژن افزایش می‌یابد. همچنین، بیان ژن TPS1 در رقم ساحل بیشتر از رقم قوزه‌درشت در تنش شوری است. این نتایج پیشنهاد می‌کند که افزایش فعالیت آنزیم پراکسیداز و افزایش بیان ژن TPS1 در مقاومت رقم ساحل به تنش شوری نسبت به رقم قوزه‌درشت نقش دارد.

کلیدواژه‌ها


عنوان مقاله [English]

Physiological and molecular studies of salinity resistance in diploid and tetraploid Cotton cultivars

نویسندگان [English]

  • Mahnaz Aghdasi
  • Batoul Kaheh
  • Mohammad Bagher Bagherieh-Najjar
Department of Biology, Faculty of Sciences, Gorgan University of Agricultural Sciences and Natural Resources, Gorgan, Iran
چکیده [English]

In this research, physiological and molecular response of diploid (Gossypium herbaceum: Ghozedorosht Mahriz) and tetraploid (Gossypium hyrsutum: Sahel) cotton cultivars were investigated under salt stress. After germination, seedlings were treated by different concentrations (0, 50, 75, 100 and 150 mM) of NaCl under greenhouse conditions. This experiment was implemented applying randomized complete block design in three replicates. The results indicated that the height of Ghozedorosht and Sahel cultivars were decreased by salt treatment. The amount of Chla, Chlb and total chlorophyll showed more reduction in Ghozehdorosht cultivar compared to Sahel cultivar under salinity. After NaCl treatment, Ghozedorosht cultivar showed higher leaf Na concentration compared to Sahel cultivar. The study of antioxidant enzyme activity showed that the peroxidase and polyphenol oxidase activity was reduced by salt treatment. But, peroxidase enzyme activity was significantly induced in Sahel cultivar by treating with NaCl. Gene expression analysis showed that salt treatment can induce TPS1 expression in leaf and root organs. The results indicated that Sahel cultivar had higher TPS1 gene expression than that of Ghozedorosht cultivar under salt stress. These results also suggested that increasing of peroxidase enzyme activity and TPS1 gene expression had important roles in Sahel cultivar to be resistant to salt stress compared to Ghozedorosht cultivar.

کلیدواژه‌ها [English]

  • Gene expression
  • Trehalose-6-phosphate synthase (TPS1)
  • Cotton
  • Salinity stress
  • Trehalose
  • 6
  • phosphate synthase (TPS1)
  • Antioxidant enzyme

 

شوری از جمله عوامل مهم محدود کننده تولید محصولات کشاورزی مختلف است. تنش شوری با کاهش پتانسیل آب، نامتعادل ساختن یون‌ها و سمّیت باعث کاهش متابولیسم گیاهی و در نهایت، کاهش محصولات زراعی می‌شود (Munns, 2002). گزارشات حاکی از آن است که بیش از 6 درصد سطح کل خاک‌های کره زمین شور است که 20 درصد آن را خاک‌های کشاورزی تشکیل می‌دهد (Flexs, 2008). میزان تحمل به شوری در گیاهان به خانواده، جنس، گونه و رقم بستگی دارد. یکی از راه‌های مقابله با شوری استفاده از گونه‌ها و ارقام مقاوم است. از این رو، لزوم به کارگیری معیارهای مناسب برای گزینش ژنوتیپ‌های مقاوم به شوری ضروری است (Jones, 1983). کمبود آب و شوری خاک فرآیندهای سازشی زیادی را در گیاهان القا می‌کنند که بسیاری از آنها با تغییر در بیان ژن‌ها همراه است. گروه‌های مختلفی از ژن‌ها در پاسخ به شوری دخالت دارند که محصول آنها به طور مستقیم یا غیر مستقیم عمل می‌کند. از این گروه ژن‌ها می‌توان ژن‌های درگیر در مسیرهای آنزیمی سنتز اسمولیت‌ها، کانال‌های یونی، گیرنده‌های مسیر انتقال پیام کلسیم و سایر پیامبران تنظیمی را نام برد که در تنظیم متابولیسم، انتقال پیام و پاسخ به تنش نقش دارند (Mahajan et al., 2008). از جمله اسمولیت‌هایی که در تنش شوری گیاهان را حفظ می‌کند، قند ترهالوز-6-فسفات (T6P) است. این قند یک دی‌ساکارید است که در سیتوزول از ترکیب دو مولکول گلوکز و
UDP-گلوکز و با فعالیت آنزیم ترهالوز 6- فسفات سنتاز (TPS) در گیاه آرابیدوپسیس سنتز می‌شود (Kolbe et al., 2005). میزان این قند در موجودات زنده بسیار اندک است (Muller et al., 1995).
T6P نقش‌های متعدد مهمی را در زندگی گیاهان ایفا می‌کند که از آن جمله می‌توان تأثیر آن بر گل‌دهی، رشد گیاه، مصرف کربن، مقاومت به تنش و فتوسنتز را نام برد Schluepmann et al., 2003)؛ Pellny et al., 2004؛ Schluepmann et al., 2004؛ Van Dijken et al., 2004). همچنین، نشان داده شده که تنش شوری و خشکی سبب افزایش غلظت این قند در گیاهان می‌شود. در واقع این قند با نگهداری و ثبات پروتئین‌ها و غشاها، گیاهان را از تنش حفظ می‌کند (Goddijn and Van Dun, 1999). نتایج حاصل از انتقال ژن TPS1 از باکتری اشیرشیاکلی به گیاه برنج نشان داده که گیاهان تراریخته نسبت به تنش شوری و خشکی مقاومت نشان می‌دهند (Garg et al.,2002).

پنبه از خانواده پنیرکان و جنسGossypium  است که تاکنون قریب 50 گونه از آن شناسایی شده است. در بین گونه‌های شناسایی شده، تنها 4 گونه به صورت زراعی در سطح جهان به زیر کشت می‌رود که گونه‌های Gossypium hirsutum و G. barbadense از گونه‌های زراعی تتراپلویید (2n=52) و گونه‌های
G. herbaceum وG. arboreum  از گونه‌های زراعی دیپلویید (2n=26) هستند که به ترتیب تحت عنوان پنبه‌های دنیای جدید و قدیم معروف هستند (Abdalla et al., 2001). G. hirsutum یک گونه تتراپلویید است که به پنبه آمریکایی یا پنبه آپلند یا پنبه الیاف متوسط معروف است (Chaudhry, 2001; Abdalla et al., 2001). G. herbaceum گونه‌ای دیپلویید پنبه است که به پنبه خاوری مشهور بوده، طول الیاف آن کوتاه است.

در پی تنش شوری تبدیل اکسیژن‌های غیر‌فعال به رادیکال‌های فعال اکسیژن سرعت می‌یابد که سبب تخریب پروتئین‌ها، لیپیدها، اسیدهای نوکلئیک و ترکیبات دیگر سلولی و متعاقباً باعث مختل شدن فرآیند‌های زیستی مانند فتوسنتز، تثبیت کربن، تثبیت ازت و افزایش شدت تنفس نوری خواهد شد (Joseph and Jini, 2010). سیستم دفاعی گیاهان برای پالایش رادیکال‌های فعال اکسیژن، کمپلکس آنتی‌اکسیدانی و آنزیم‌های آنتی‌اکسیدان از قبیل کاتالاز (CAT)، پراکسیداز، پلی فنل اکسیداز است (Foyer and Halliwell, 1976). در صورتی که بین تولید رادیکال‌های فعال اکسیژن و دفاع آنتی‌اکسیدانی تعادل وجود نداشته باشد، تنش اکسیداتیو و متعاقب آن به گیاه صدمه وارد می‌شود (Mittler, 2002).

هدف از تحقیق حاضر، مقایسه دو رقم دیپلویید و تتراپلویید پنبه در تیمار شوری در سطح فیزیولوژیک و مولکولی است. در این تحقیق، ضمن بررسی انواع شاخص‌های مورفولوژیک و فیزیولوژیک مرتبط با شوری، بیان ژن TPS1 در اندام‌های مختلف پنبه در دو رقم یاد شده در پاسخ به شوری مقایسه خواهد شد.

 

مواد و روش‌ها

مواد گیاهی و شرایط کشت

بذرهای پنبه رقم ساحل (تتراپلویید) و قوزه‌درشت (دیپلویید) از مرکز تحقیقات پنبه گرگان تهیه و پس از ضد‌عفونی سطحی با آب ژاول 10 درصد روی کاغذ صافی قرار داده شدند. جوانه‌زنی در شرایط آزمایشگاه و در دمای 25 درجه سانتیگراد انجام گرفت. سپس گیاهچه‌های 6 روزه به محیط‌کشت هوگلند با 5 سطح شوری 0، 50، 75، 100، 150 میلی‌مولار کلرید سدیم در شرایط گلخانه انتقال داده شدند و پس از 4 هفته برداشت گیاهچه‌ها صورت گرفت. تعویض محیط‌کشت هوگلند به طور هفتگی و کنترل اسیدیته محیط‌کشت به طور روزانه انجام شد. آزمایش در قالب طرح بلوک کامل تصادفی با سه تکرار در محیط تحت کنترل انجام شد. پس از برداشت، طول گیاهچه‌ها (طول ریشه و بخش هوایی)، میزان کلروفیل، سدیم، فعالیت آنزیم‌های اکسیداتیو و بیان ژن TPS بررسی شد.

تعیین محتوای کلروفیل

اندازه‌گیری کلروفیل به روش Arnon (1949) انجام گرفت. بدین منظور، مقدار 05/0 گرم از بافت تر بخش هوایی با 5 میلی‌لیتر استون 80 درصد ساییده شد. مخلوط به دست آمده به مدت 10 دقیقه در 13000 دور سانتریفیوژ شد، در نهایت، محلول رویی عصاره جدا و حجم نهایی آن با استون 80 درصد به حجم 8 میلی‌لیتر رسانده شد. سپس میزان جذب آن را در دو طول موج 645 و 663 نانومتر با کمک دستگاه اسپکتروفتومتر اندازه‌گیری شد.

اندازه‌گیری میزان سدیم

به این منظور، مقدار 50 میلی‌گرم از نمونه‌های خشک آسیاب شده به مدت 30 دقیقه در دمای 300 درجه سانتیگراد و سپس 4 ساعت در دمای 550 درجه سانتیگراد در کوره الکتریکی قرار گرفتند. پس از سرد شدن به هر کدام از ظروف حاوی خاکستر گیاهی، 1 میلی‎لیتر کلریدریک اسید 6 نرمال اضافه شد. سپس حجم محلول با آب مقطر به 50 میلی‎لیتر رسانده شد. برای اندازه‎گیری میزان سدیم از دستگاه فلیم فلومتر استفاده شد. غلظت یون‎های سدیم در نمونه‎های گیاهی با استفاده از منحنی استاندارد و بر حسب میلی‎گرم در گرم وزن خشک بافت محاسبه شد.

اندازه‌گیری فعالیت آنزیم‌های کاتالاز، پراکسیداز، پلی فنل اکسیداز

عصاره‌گیری با استفاده از روش Kar و Mishra (1976) صورت گرفت. برای این منظور مقدار 05/0 گرم بافت در هاون چینی سرد و در ظرف یخ با 2 میلی‌لیتر بافر فسفات 1/0 مولار با اسیدیته 8/6، همگن و سپس برای مدت 15 دقیقه در g 17000 در دمای 4 درجه سانتیگراد سانتریفیوژ شد. محلول رویی عصاره (سوپرناتانت) به دست آمده برای اندازه‌گیری فعالیت سه آنزیم کاتالاز، پراکسیداز و پلی فنل اکسیداز استفاده شد. اندازه‌گیری فعالیت آنزیم کاتالاز و پراکسیداز نیز با استفاده از روش Chance و Maehly (1955) صورت گرفت. اندازه‌گیری فعالیت کاتالاز و پراکسیداز با روش سینتیک و در طول موج 240 و 470 نانومتر با استفاده از اسپکتروفتومتر (Shimidzu UV-160) انجام شد. فعالیت آنزیم پلی فنل اکسیداز به روش Resende و همکاران (2002) اندازه‌گیری شد. 100 میلی‌مولار تریس و اسیدیته 5/8، 100 میلی‌مولار کلرید سدیم، 20 میلی‌مولار اتیلن دی آمین تترا استیک اسید (EDTA)، سارکوزین 1 درصد.

استخراج RNA

استخراج RNA از برگ و ریشه گیاهچه‌های پنبه مطابق با روش Sambrook و Russell (2001) صورت گرفت. به این منظور میزان 1/0 تا 5/0 گرم بافت تازه برگ یا ریشه در نیتروژن مایع ساییده شد، سپس به آن مقدار 750 میکرولیتر بافر استخراج اضافه شد. پس از افزودن 750 میکرولیتر مخلوط فنل-کلروفرم-ایزو آمیل الکل (به نسبت 1:24:25) به مدت 2 دقیقه مخلوط شد و روی یخ به مدت 5 دقیقه انکوبه گردید. پس از سانتریفیوژ، فاز آبی به لوله جدید منتقل و مجدداً مخلوط فنل-کلروفرم-ایزو آمیل الکل به آن اضافه گردید. پس از انجام سانتریفیوژ، فاز مایع رویی برداشته و پس از اضافه کردن یک حجم ایزو پروپانول به آن، به مدت 5 دقیقه در دمای اتاق انکوبه گردید. پس از سانتریفیوژ به مدت 10 دقیقه و حذف محلول رویی، رسوب به دست آمده در 5/0 میلی‌لیتر آب مقطر استریل حل و 5/0 میلی‌لیتر کلرید لیتیوم 4 مولار به آن اضافه شد. در مرحله بعد، نمونه به دست آمده به مدت 3 ساعت بر روی یخ انکوبه شد و پس از 20 دقیقه سانتریفیوژ، رسوب به دست آمده در آب مقطر استریل حل گردید. با افزودن استات سدیم 3 مولار و اتانول 96 درصد محلول به دست آمده به مدت یک شب در فریزر20- درجه انکوبه گردید و پس از سانتریفیوژ و شستشوی با اتانول 70 درصد، رسوب به دست آمده در آب مقطر استریل حل و در 80- درجه سانتیگراد نگهداری شد. غلظت RNA استخراج شده توسط اسپکتروفتومتر در طول موج 260 نانومتر تعیین شد. به منظور حذف DNA ژنومیک، 10 نانوگرم از RNA استخراج شده با 2 واحد ازDNase  (DNA- free, Ambion, Austin, USA) تیمار شد.

طراحی پرایمر

پرایمرهای ویژه ژن هدف TPS1 (Forward and Reverse) و ژن کنترل اکتین ویژه گیاه پنبه(Actin-F and R) با استفاده از نرم‌افزار Primer 3 طراحی (جدول 1) و توسط شرکت امینسان سنتز شدند.

واکنش RT-PCR

واکنش RT-PCR با استفاده ازکیت Prime Script One Step RT-PCR ساخت شرکت TAKARA BIO INC Japanese انجام شد. این واکنش در حجم نهایی 25 میکرولیتر با محتوی 2 میکروگرم RNA، 1 واحد آنزیم Prime Script، 5/12 میکرولیتر بافر آنزیم Prime Script، 5/0 میکرولیتر از هر یک از پرایمرهای R و F در دستگاه PCR با برنامه حرارتی: واسرشته شدن در دمای 94 درجه سانتیگراد به مدت 2 دقیقه برای چرخه اول و برای چرخه دوم به بعد به مدت 30 ثانیه، اتصال آغازگرها در دمای 60 درجه به مدت 30 ثانیه و بسط در دمای 72 درجه به مدت 1 دقیقه درجه انجام شد. محصول PCR با استفاده از دستگاه الکتروفورز روی ژل آگاروز 2 درصد جداسازی شد. در پایان ژل‌های به دست آمده با اتیدیوم بروماید رنگ‌آمیزی شدند.

 

 

جدول1- توالی پرایمرهای ژن‌های TPS1 و اکتین گیاه پنبه

اندازه محصول

پرایمر برگشت

پرایمر رفت

ژن هدف

323

TAAGCTGCGAGGGATGG

CTGCGAGCCCAATATGCCAC

TPS

300

GTAGATGGGGACGGTGGAG

ATTGTGAGCAACTGGGATGA

اکتین

 

 

نتایج

بررسی فیزیولوژیک

مقایسه رشد رویش

نتایج حاصل از اندازه‌گیری طول گیاهچه در تیمارهای مختلف نمک نشان داد که در غلظت‌های صفر و 50 میلی‌مولار نمک، طول گیاهچه‌های رقم ساحل و رقم قوزه‌درشت تفاوت معنی‌داری ندارند. افزایش غلظت نمک در تیمار 75 میلی‌مولار تأثیری بر طول گیاهچه‌های رقم ساحل نداشته، با این حال، طول گیاهچه‌های رقم قوزه‌درشت به طورمعنی‌داری کاهش نشان داد. افزایش بیشتر غلظت نمک در محیط‌کشت باعث کاهش شدید طول گیاهچه‌های رقم قوزه‌درشت نسبت به رقم ساحل شده است، به طوری که با تیمار 150 میلی‌مولار نمک 40 درصد از طول گیاهچه‌های قوزه‌درشت نسبت به تیمار شاهد کاسته شد، در حالی که در این سطح از نمک تنها 20 درصد از طول گیاهچه‌های رقم ساحل نسبت به تیمار شاهد کاسته شده است (شکل 1).

 

شکل 1- مقایسه طول گیاهچه‌های ساحل و قوزه‌درشت در پاسخ به تنش شوری. مقادیر میانگین 3 بار تکرار است. حروف یکسان بیانگر عدم اختلاف معنی‌دار با استفاده از آزمون LS Means در سطح P<0.05 است.

میزان سدیم

نتایج حاصل از اندازه‌گیری میزان سدیم در غلظت صفر میلی‌مولار نمک نشان داده که مقدار سدیم در هر دو رقم یکسان است. با افزایش غلظت نمک در محیط کشت میزان این عنصر در هر دو رقم افزایش نشان داد. غلظت سدیم در رقم قوزه‌درشت در تیمارهای 50، 75 و 100 میلی‌مولار سدیم تفاوت معنی‌داری را نشان نداد. افزایش غلظت نمک تا 150 میلی‌مولار سبب افزایش درخور توجه در میزان سدیم رقم قوزه‌درشت شد. میزان سدیم گیاهچه‌های رقم ساحل نیز با افزایش غلظت نمک افزایش پیدا کرد، اما در سطوح مختلف نمک میزان سدیم در رقم ساحل به طور معنی‌داری کمتر از رقم قوزه‌درشت است (شکل 2).

 

شکل 2- اندازه‌گیری میزان سدیم در برگ گیاهچه‌های پنبه رقم ساحل و قوزه‌درشت در تیمار شوری. مقادیر میانگین 3 بار تکرار است. حروف یکسان بیانگر عدم اختلاف معنی‌دار با استفاده از آزمون LS Means در سطح P<0.05 است.

 

اندازه‌گیری مقدار کلروفیل

در رقم ساحل میزان کلروفیل a، b و کلروفیل کل در تیمار صفر میلی‌مولار نمک به ترتیب 40، 79 و 62 درصد بیشتر از مقدار آن در رقم قوزه‌درشت است (شکل 3- الف، ب و ج)، در حالی که نسبت کلروفیل a/b در رقم قوزه‌درشت بیشتر از رقم ساحل است (شکل 3- د). با افزایش غلظت نمک در محیط‌کشت از مقدار کلروفیل در هر دو رقم کاسته شد، اما تا غلظت 100 میلی‌مولار نمک، همچنان میزان کلروفیل a، b و کلروفیل کل به طور معنی‌داری در رقم ساحل بیشتر از رقم قوزه‌درشت است. با افزایش بیشتر غلظت نمک تا 150 میلی‌مولار میزان کلروفیل در دو رقم مورد بررسی تفاوت معنی‌داری را نشان نداد. بررسی حاضر نشان داد که در رقم قوزه‌درشت نسبت کلروفیل a/b تا غلظت 100 میلی‌مولار نمک، بیشتر از این نسبت در رقم ساحل است، اما در تیمار 150 میلی‌مولار نمک این نسبت تفاوت معنی‌داری را در دو رقم مورد بررسی نشان نمی‌دهد (شکل 3- د).

بررسی فعالیت آنزیم‌های آنتی‌اکسیدان

بررسی فعالیت آنزیم پلی فنل اکسیداز در گیاهچه‌های پنبه نشان داد که در غلظت صفر میلی‌مولار نمک فعالیت این آنزیم در رقم قوزه‌درشت به طور معنی‌داری کمتر از میزان فعالیت این آنزیم در رقم ساحل است. افزایش غلظت نمک باعث کاهش فعالیت این آنزیم را در رقم قوزه‌درشت شده است. همچنین، نتایج حاضر نشان داد که افزایش غلظت نمک تا 75 میلی‌مولار تغییر معنی‌داری را در فعالیت این آنزیم در رقم ساحل پدید نیاورده است، اما با افزایش بیشتر غلظت نمک از فعالیت این آنزیم کاسته شده است. در مجموع، در تمامی سطوح شوری بررسی شده، فعالیت آنزیم پلی فنل اکسیداز در رقم ساحل به طور معنی‌داری بیشتر از رقم قوزه‌درشت است. فعالیت این آنزیم در رقم ساحل در تیمار 150 میلی‌مولار نمک 54 درصد بیشتر از فعالیت آن در رقم قوزه‌درشت است (شکل 4- الف). بررسی فعالیت آنزیم پراکسیداز نیز نشان داد که تا غلظت 75 میلی‌مولار نمک تفاوت معنی‌داری در فعالیت این آنزیم در دو رقم مورد بررسی وجود ندارد. افزایش غلظت نمک تا 100 و 150 میلی‌مولار باعث افزایش معنی‌دار فعالیت این آنزیم در رقم ساحل نسبت به رقم  قوزه‌درشت شده است؛ در حالی که در غلظت 150 میلی‌مولار نمک فعالیت این آنزیم در رقم ساحل 73 درصد افزایش را نسبت به تیمار شاهد نشان می‌دهد. فعالیت این آنزیم در رقم قوزه‌درشت به طور معنی‌داری نسبت به تیمار شاهد کاهش معنی‌داری را نشان می‌دهد (شکل4- ب). بررسی فعالیت آنزیم کاتالاز در گیاهچه‌های مورد بررسی نشان داد که میزان فعالیت این آنزیم در رقم ساحل در غلظت‌های صفر و 50 میلی‌مولار نمک به طور معنی‌داری بیشتر از فعالیت این آنزیم در رقم قوزه‌درشت است؛ در حالی که در غلظت‌های 75 و 100 میلی‌مولار نمک فعالیت این آنزیم تفاوت معنی‌داری را در دو رقم مورد بررسی نشان نمی‌دهد. تیمار 150 میلی‌مولار نمک باعث کاهش شدید فعالیت این آنزیم در رقم قوزه‌درشت شده است (شکل4- ج).


 

   

(الف)

(ب)

   

(ج)

(د)

شکل 3- نمودار مقایسه میزان کلروفیل a، b و کلروفیل کل و نسبت کلروفیل  a/bدر گیاهچه‌های پنبه رقم ساحل و قوزه‌درشت در تنش شوری. مقادیر میانگین 3 بار تکرار است. حروف یکسان بیانگر عدم اختلاف معنی‌دار با استفاده از آزمون LS Means در سطح P<0.05 است.

 

 

تحلیل بیان ژن

مقایسه الگوی بیان ژن TPS1 در دو رقم ساحل و قوزه‌درشت نشان داد که در غلظت صفر میلی‌مولار کلرید سدیم میزان بیان این ژن در ریشه هر دو رقم بسیار پایین است، اما میزان بیان این ژن در برگ رقم ساحل تا حدودی بیشتر از میزان بیان آن نسبت به برگ رقم قوزه‌درشت است. بررسی بیان این ژن در غلظت 150 میلی‌مولار کلرید سدیم نشان داد که شوری باعث افزایش میزان بیان این ژن می‌شود. مقایسه بیان ژن TPS1 در دو اندام ریشه و برگ در تیمار 150 میلی‌مولار نمک نشان می‌دهد که میزان بیان این ژن در برگ بیشتر از ریشه است. همچنین، مقایسه الگوی بیان ژن TPS1 در دو رقم ساحل و قوزه‌درشت نشان داد که شوری بیان این ژن را در اندام برگ رقم ساحل به طور قابل توجهی تحریک می‌کند (شکل 5).


 

   

(الف)

(ب)

 

 

شکل 4- فعالیت آنزیم‌های پلی فنل اکسیداز، پراکسیداز و کاتالاز در گیاهچه‌های پنبه رقم ساحل و قوزه‌درشت در تنش شوری. مقادیر میانگین 3 بار تکرار است. حروف یکسان بیانگر عدم اختلاف معنی‌دار با استفاده از آزمون LS Means در سطح P<0.05 است.

 

 

(ج)

 

 

 

 

 

شکل 5- الگوی بیان ژن TPS1 در اندام‌های ریشه و برگ رقم‌های ساحل و قوزه‌درشت در تیمار شوری. در این آزمایش از اکتین به عنوان شاهد داخلی استفاده شده است.

     

 

 

بحث

شوری بالا با افزایش جذب یون‌های Na+ و ־Cl موجب کاهش رشد (Garcia-Lidon et al., 1998)، کاهش جذب آب (Desikan et al., 2005)، عدم توازن در جذب سایر یون‌های مغذی (Passarakli and Tucker, 1988)، افزایش اثر جذب انتخابی و آثار متقابل رقابتی یون‌ها (Griere and Walker, 1983) و نیز کاهش هدایت روزنه‌ای و جذب CO2 می‌شود (Banuls and Primo-Millo, 1992). مطالعات انجام شده روی برنج (Ashraf and Bhatti, 2000)، بادام‌زمینی (Hajar et al., 1993) و پروانش (Jaleel and Sridharan, 2008) نشان داده است که با افزایش شوری از میزان کلروفیل، فتوسنتز و در نهایت، میزان محصول کاسته می‌شود. علل متعددی در کاهش کلروفیل نقش دارند که از جمله می‌توان به از بین رفتن غشا (Ashraf and Ahmad, 2000)، ناپایداری کمپلکس پروتئینی رنگیزه‌ها و یا کاهش سنتز کلروفیل اشاره کرد (Levitt, 1980). در واقع، کاهش میزان کلروفیل برگ در طی تنش شوری می‌تواند حاصل آسیب اکسیداتیو باشد که در اثر تولید رادیکال‌های فعال اکسیژن و اختلال در متابولیسم کلروپلاست روی می‌دهد (Rout and Shaw, 2001) که متعاقب آن افزایش نسبت کلروفیل a/b و کاهش بازده فتوسنتزی برگ‌ها اتفاق می‌افتد (Koyro, 2006). نتایج حاصل از اندازه‌گیری میزان سدیم در غلظت‌های مختلف شوری در دو رقم ساحل و قوزه‌درشت نشان داد که با افزایش شوری میزان نمک در هر دو رقم مورد بررسی افزایش می‌یابد، اما افزایش میزان نمک در رقم قوزه‌درشت به طور معنی‌داری بیشتر از رقم ساحل است. سمّیت یونی ناشی از شوری، از توسعه برگ‌های جوان جلوگیری می‌کند و چنانچه این وضع ادامه یابد، باعث پیری زودرس آنها می‌شود (Munns and Tester, 2008). تجمع سدیم در سیتوپلاسم سلول باعث القای تولید رادیکال‌های فعال اکسیژن در سلول می‌شود (Mayer, 2006)، بنابراین، بافت‌های گیاهی برای کنترل میزان رادیکال‌های فعال اکسیژن و حفاظت سلول‌ها در شرایط تنش از آنزیم‌های آنتی‌اکسیدان نظیر کاتالاز، پراکسیداز و پلی فنل اکسیداز استفاده می‌کنند (Asada, 1999). افزایش میزان فعالیت آنزیم‌های آنتی‌اکسیدان می‌تواند در تحمل گیاهان به شوری نقش داشته باشد (Agarwal and Pandey, 2004؛ (Mandhania et al., 2006. افزایش فعالیت برخی آنزیم‌های آنتی‌اکسیدان تحت شرایط شوری در کتان (Desingh and Kanagaraj, 2007)، برنج (Fadzilla and Finch, 1997)، خیار (Lechno et al., 19970، ساقه گندم (Menogeuzzo and Navari-Izzo, 1999) و نخودفرنگی (Hegedus et al., 2001) گزارش شده است. در این خصوص سطوح تولید H2O2 داخل سلولی توسط کاتالاز و پراکسیداز تنظیم می‌شود (Joseph and Jini, 2010). گزارش‌ها گویای آن است که در ارقام مقاوم گیاهانی نظیر پنبه (Gossett et al., 1994)، یونجه (Wang et al., 2009)، فلفل (Turhan et al., 2006)، لوبیا (Hernandez et al., 1993) و نخود (Singh, 2004) میزان فعالیت آنزیم پراکسیداز بیشتر از میزان فعالیت این آنزیم در ارقام حساس است. پراکسیدازها با مصرف H2O2 در دیواره سلولی، اکسیداسیون انواعی از ترکیبات آلی از جمله فنولیک‌ها را برای تشکیل لیگنین یا سوبرین کاتالیز می‌کنند (Quiroga et al., 2000). همچنین، آنزیم پراکسیداز علاوه بر مصرف H2O2 و کاهش آسیب‌های حاصل از آن، با لیگنینی ساختن دیواره، سدی فیزیکی در برابر سمّیت یون‌های کلرید سدیم ایجاد می‌کند (Hegedus et al., 2001). نتایج حاضر نشان داد که در رقم مقاوم ساحل آنزیم پلی فنل اکسیداز عملکرد بهتری نسبت به رقم حساس قوزه‌درشت دارد. آنزیم پلی فنل اکسیدار هم مانند پراکسیداز با مصرف H2O2 و سنتز لیگنین سد فیزیکی در مقابل یون‌های سمّی می‌سازد و از صدمه بیشتر به گیاهان جلوگیری می‌کند (Badar et al., 2006).

در ارقام مقاوم به شوری گیاهانی نظیر نخود‌فرنگی (Hernandez and Almansa, 2002)، چغندر‌قند (Bor et al., 2003) و نخود (Singh, 2004) فعالیت آنزیم کاتالاز بیشتر از ارقام حساس است. نتایج حاضر نشان داد که اگرچه با افزایش غلظت نمک فعالیت آنزیم پلی فنل اکسیداز به طور معنی‌داری در رقم ساحل بیشتر از رقم غوزه‌درشت است، اما فعالیت این آنزیم در هر دو رقم مورد بررسی، با افزایش شوری کاهش یافته است. فعالیت آنزیم کاتالاز نیز با افزایش غلظت نمک در هر دو رقم به طور معنی‌داری کاهش یافته است (شکل 4). به نظر می‌رسد که افزایش غلظت نمک باعث تولید بیش از حد پراکسید هیدروژن شده، در نهایت، توانسته آنزیم کاتالاز را غیر فعال سازد (Mashoudi et al., 1997). نتایج حاصل از بررسی فعالیت آنزیم پلی فنل اکسیداز نشان داد که با افزایش غلظت نمک فعالیت این آنزیم در رقم ساحل به طور معنی‌داری افزایش می‌یابد. این امر نشان می‌دهد که این آنزیم نقش مهمی در مقابله با تنش اکسیداتیو حاصل از شوری در رقم ساحل ایفا می‌کند. نتایج حاصل از آنالیزهای بیوشیمیایی و فیزیولوژیک گیاهچه‌های دو رقم ساحل و قوزه‌درشت پنبه در تیمار شوری نشان داد که غلظت‌های 75، 100 و 150 میلی‌مولار کلرید سدیم در رقم حساس قوزه‌درشت و غلظت‌های 100 و 150 میلی‌مولار کلرید سدیم در رقم مقاوم ساحل، تنش اکسیداتیو ایجاد می‌کند. رادیکال‌های فعال اکسیژن تولید شده در طی تنش اکسیداتیو باعث تخریب پروتئین‌ها و لیپیدهای غشایی و اسیدهای نوکلئیک خواهد شد Chance and Maehly, 1955)؛ Rout and Shaw, 2001). این امر باعث تخریب ساختار کلروپلاستی و ناپایداری کمپلکس‌های پروتئینی گیرنده نور می‌شود (Singh, 2004). در نهایت، میزان کلروفیل برگ کاهش یافته، با پایین آمدن سطح فتوسنتز و متابولیسم سلولی، بیوماس گیاهی کاهش می‌یابد، در مقابل هنگامی که گیاهان مقاوم در شرایط تنش قرار گیرند، با افزایش فعالیت آنزیم‌های آنتی‌اکسیدان تولید رادیکال‌های فعال اکسیژن را کاهش داده، فتوسیستم‌ها را در مقابل آسیب‌های تنش اکسیداتیو حفاظت می‌کنند (Ashraf, 2009).

همچنین، نتایج حاصل از انتقال ژن TPS1 از مخمر به گیاه تنباکو نشان داد که در گیاهان تراریخت میزان کلروفیل و شدت فتوسنتز در واحد سطح برگ افزایش می‌یابد. این نتایج نشان می‌دهد که میزان T6P با شدت فتوسنتز رابطه مستقیم دارد (Pilon-Smits et al., 1998; Pellny et al., 2004). اخیراً گزارش‌های متعددی از دست‌ورزی ژنی برای تولید گیاهان با سطح T6P بالاتر و تولید گیاهان مقاوم به انواع تنش‌های خشکی، سرما و شوری در تک‌لپه ای‌ها و دولپه‎ای‎ها گزارش شده است (Miranda et al., 2007). انتقال ژن TPS و TPP (ترهالوز-6-فسفات فسفاتاز) باکتریایی به گیاه برنج نیز باعث افزایش غلظت T6P و مقاومت به تنش شده است (Iordachescu and Imai, 2008). به‌علاوه، TPS باکتریایی و یا مخمر در گیاهان برنج تراریخت شده در مقایسه با گیاهان کنترل در معرض تنش خشکی، کاهش تخریب فتواکسیداتیو را نشان دادند که متعاقب آن، سطح فتوسنتز در حد مطلوب نگه داشته شده است. از این نتایج می‌توان دریافت که متابولیسم ترهالوز (که در کلروپلاست سلول صورت می‌گیرد) در حفاظت گیاه از آسیب‌های ناشی از تنش غیر زنده دخالت دارد (Garg et al., 2002). تحمل خشکی از طریق افزایش بیان TPS1 در کلروپلاست به این نکته اشاره می‌کند که T6P به عنوان سیگنالی مهم در پاسخ به تنش خشکی عمل می‌کند (Schluepmann and Paul, 2009). Avonce و همکاران (2004) نشان دادند که بیان بالای ژن AtTPS1 در آرابیدوپسیس تالیانا به ایجاد فنوتیپ‌های حساس به ABA و گلوکز منجر می‌شود. این امر اثبات می‌کند که آنزیم AtTPS1 با سیگنالینگ ABA و قند در طول رشد رویشی نقش دارد، تحمل خشکی در آنها حاصل فرآیندهای سیگنالینگ این آنزیم است. از طرفی دیگر، نتایج حاصل از آزمایش‌های میکرواری (microarray) در گیاهچه‌های آرابیدوپسیس نشان داده است که ترهالوز باعث بیان ژن‌های مرتبط با رادیکال‌های فعال اکسیژن و متابولیسم ثانویه می‌گردد. این نتایج نشان داده است که ترهالوز باعث بیان ژن‌هایی می‌شود که در پاسخ به تنش‌های زیستی دخالت دارند (Aghdasi et al., 2008).

بررسی‌های انجام شده بر روی الگوی بیان ژن TPS1 در اندام‌های مختلف گیاه پنبه، رقم متحمل به خشکی (سوکرال 23)، در تیمار با 6000 PEG نقش سیگنالی T6P را در تحمل به تنش اسمزی نشان داده است (Sotirios et al., 2006). نتایج این گزارش نشان داد که بیان TPS1 در برگ‌ها بیشتر از میزان بیان آن در اندام ریشه است. نتایج حاضر نیز نشان داد که بیان ژن TPS1 در برگ و ریشه دو رقم ساحل و قوزه‌درشت با تیمار شوری افزایش یافته، میزان بیان آن در اندام برگ بیشتر از اندام ریشه است. همچنین، این نتایج نشان داد که بیان ژن TPS1 در رقم ساحل که رقمی تتراپلویید است، نسبت به رقم قوزه‌درشت که رقمی دیپلویید است، بیشتر است. از آنجایی که در ارقام دیپلویید یک کپی از ژن TPS1 در ژنوم گیاه پنبه وجود داشته و با توجه با اینکه رقم ساحل از گونه تتراپلویید بوده و در اللوپلوییدی گیاه پنبه همه ژن‌های هسته‌ای دو برابر شده است (Wendel and Cronn, 2002; Sotirios et al., 2006)، به نظر می‌رسد که این امر در مقاوم ساختن رقم ساحل در مقابل تنش شوری نقش داشته باشد. همچنین، با توجه به تحقیقات یاد شده سطح بالای بیان TPS1 در غلظت 150 میلی‌مولار نمک در رقم ساحل بر فعالیت آنزیم‌های آنتی‌اکسیدان اثر مطلوب داشته و با بالا نگه داشتن میزان کلروفیل‌های a و b، از کاهش سطح فتوسنتز در تنش شوری جلوگیری و متعاقب آن متابولیسم نرمال سلولی و بیوماس گیاهی در گیاهچه‌های رقم ساحل تا حدی بیشتر از رقم قوزه‌درشت حفظ می‌شود.

 

جمع‌بندی

نتایجحاضر اطلاعات اولیه‌ای در ارتباط با بیان ژن TPS1 در پاسخ به تنش شوری در ارقام دیپلویید و تتراپلویید گیاه پنبه فراهم آورده است. این اطلاعات می‌تواند در مراحل بعدی در انتقال ژن TPS1 به گیاه پنبه و تولید ارقام مقاوم به تنش با طول الیاف بلند استفاده شود.

 

 

تشکر و قدردانی

نویسندگان مقاله از حوزه معاونت پژوهش و فناوری دانشگاه گلستان برای حمایت مالی این تحقیق نهایت تشکر و قدردانی را دارند.

 
 

Abdalla, A. M., Reddy, O., El-Zik, K. M., and Pepper, A. E. (2001) Genetic diversity and relationships of diploid and tetraploid cottons revealed using AFLP. Theoritical and Applied Genetics 102: 222-229.

Agarwal, S. and Pandey, V. (2004) Antioxidant enzyme responses to NaCl stress in Cassia angustifolia. Biologia Plantarum 48: 555-560.

Aghdasi, M., Smeekens, S. and Schluepmann, H. (2008) Microarray analysis of gene expression patteren in Arabidopsis seedlings under trehalose, sucrose and sorbitol treatment. International Journal of Plant Production 4: 1753-1763.

Arnon, D. I. (1949) Copper enzymes in isolated chloroplast. polyphenoloxidase in beta vulgaris. Plant Physiology 24: 1-10.

Asada, K.(1999) The water-water cycle in chloroplasts: scavenging of active oxygen and dissipation of excess photons. Annual Review of Plant Physiology and Plant Molecular Biology 50: 601-639.

Ashraf, M.(2009) Biotechnological approach of improving plant salt tolerance using antioxidants as markers. Biotechnology Advances 27: 84-93.

Ashraf, M. and Ahmad, S.(2000) Influence of sodium chloride on ion accumulation, yield components, and fiber characteristics in salt-tolerant and salt-sensitive lines of cotton (Gossypium hirsutum L.). Field Crops Research 66: 115-127.

Ashraf, M. Y. and Bhatti, A. S.(2000) Effect of salinity on growth and chlorophyll content of Rice. Pakistan Journal of Science Industrial Research 43: 130-131.

Avonce, N., Leyman, B., Mscorro-Gallardo, J. O., Van Dijck, P., Thevelein, J. M., and Iturriage, G. (2004) The Arabidopsis Trehalose-6-phosphate Synthase AtTPS1 gene is a regulator of glucose, abscisic acid and stress signaling. Plant Physiology 136: 3649-3659.

Badar Ali, M., Singh, N., Shohael, A. M., Hahn, E. N. and Paek, K. Y. (2006) Phenolics metabolism and lignin synthesis in root suspension cultures of Panax ginseng in response to copper stress. Plant Science 171: 147-154.

Banuls, J. and Primo-Millo, E. (1992) Effects of chloride and sodium on gas exchange parameters and water relation of citrus plants, Physiologia Plantarum 86: 115-123.

Bor, M., Ozdemir, F and Turkan, I.(2003) The effect of salt stress on lipid peroxidation and antioxidants in leaves of suger beet Beta vulgaris L. and wild beet Beta maritime L. Plant Science 164: 77-84.

Chance, M. and Maehly, A. C.(1955) Assay of catalases and peroxidases. Methods Enzymology 2: 764-817.

Chaudhry, M. R. (2001) Cost of production of new cotton International cotton advisory. International Cotton advisory committee, Washington.

Desikan, R., Hancock, J. and Neill, S. (2005) Reactive oxygen species as signaling molecules. In: Antioxidants and Reactive Oxygen Species in plants (ed. Smirnoff, N.) 169-196. Blackwell publication, Oxford.

Desingh, R. and Kanagaraj, G.(2007) Influence of salinity stress on photosynthesis and antioxidative systems in two cotton varieties. Genetic Applied Plant Physiology 33: 221-234.

Fadzilla, N. M. and Finch, R. H.(1997) Salinity, oxidative stress and antioxidant responses in shoot cultures of rice. Journal of Experimental Botany 48: 325-331.

Flexs, J. (2008) FAO land and plant nutriotion management service. Retrieved from http://www.fao.org/ag/agI/agII/spush. on: 25 April 2008.

Foyer, C. and Halliwell, B.(1976) The presence of glutathione and glutathione reductase in chloroplasts: a proposed role in ascorbic acid metabolism. Planta 133: 21-25.

Garcia-Lidon, J. M., Ortiz, J. M., Garcia-Leqaz, M. F. and Cerda, A.(1998) Role of root stock and scion on root and leaf ion accumulation in lemon trees grown under saline condition. Fruits 53: 89-97.

Garg, A. K., Kim, J. K., Owens, T. G., Ranwala, A. P., Choi, Y. D., Kochian, L. V. and Wu, R. J. (2002) Trehalose accumulation in rice plants confers high tolerance levels to different abiotic stresses. Proceeding of the Natural Academy of Sciences of the United States 99: 15898-15903.

Goddijn, O. and Van Dun, K. (1999) Trehalose metabolism in plants. Trends Plant Sciences 4: 315-319.

Gossett, D. R., Millhollon, E. P. and Lucas, M. C. (1994a) Antioxidant response to NaCl stress in salt-tolerant and salt-sensitive cultivars of cotton. Crop Science 34: 706-714.

Griere, C. M. and Walker, R. R.(1983) Uptake and distribution of chloride, sodium and pottasium ions in salt- treated citrus plants. Australian Journal of Agricultural Researches 34: 133-143.

Hajar, A. S., Heikal, M. M., Maghrabi, Y. M. and Abuzinadah, R. A. (1993) Responses of Arachis hypogaea (Peanut) to salinity stress. Journal King Saud University Agricultural Sciences 5: 5-13.

Hegedus, A., Erdei, S. and Horvath, G. (2001) Comparative studies of H2O2 detoxifying enzymes in green and greening barley seedlings under cadmium stress. Plant Sciences 160: 1085-1093.

Hernandez, J. A. and Almansa, M. S.(2002) Short-term effects of salt stress on antioxidant systems and leaf water relations of pea leaves. Plant Physiology 115: 251-257.

Hernandez, J. A., Rio, L., Del Sevilla., F. and Del Rio, L. (1993) Effect of salinity on metallo-enzymes of oxygen metabolism in two leguminous plants. Journal of Plant Nutrition 16: 2539-2554.

Iordachescu, M. and Imai, R. (2008) Trehalose biosynthesis in response to abiotic stresses. Journal of Integrative Plant Biology 50: 1223-1229.

Jaleel, C. A. and sridharan, R. (2008) Soil salinity alters growth, chlorophyll content and secondary metabolite accumulation in catharanthus roseus. Turkish Journal of Biology 32: 79-83.

Jones, J. B. (1983) Aguide for the hydroponic and soilless culture grower. Timber press, Portland.

Joseph, B. and Jini, D. (2010) Insight into the role of antioxidant enzymes for salt tolerance in plants. International Jornal of Botany 6: 456-464.

Kar, M. and Mishra, D. (1976) Catalase, peroxidase, and polyphenoloxidase actives during rice leaf senescence. Plant Physiology 57: 315-319.

Kolbe, A., Tiessen, A., Schluepmann, H., Paul, M., Ulrich, S. and Geigenberger, P. (2005) Trehalose 6-phosphate regulates starch synthesis via posttranslational redox activation of ADP-glucose pyrophosphorylase. Proceeding of the Natural Academy of Sciences of the United States 102: 11118-11123.

Koyro, H. W. (2006) Effect of salinity on growth, photosynthesis, water relations and solute composition of the potential cash crop halophyte Plantago coronopus (L.). Environmental and Experimental Botany 56: 136-146.

Lechno, S., Zamki, E. and Tel-Or, E. (1997) Salt stress-induced responses in cucumber plants. Journal of Plant Physiology 150: 206-211.

Levitt, J. (1980) Response of Plants to Environmental Stresses. vol. 2. Academic Press, New York.

Mahajan, S., Pandey, G. K. and Tuteja, N. (2008) Calcium- and salt-stress signaling in plants: shedding light on SOS pathway. Archives of Biochemistry and Biophysics 471: 146-158.

Mandhania, S., Madan, S. and Sawhney, V. (2006) Antioxidant defense mechanism under salt stress in wheat seedlings. Plant Biology 50: 227-231.

Mashoudi, S., Choui, A., Ghorbal, M. H. and Ferjani, E. E. (1997) Response of antioxidant enzymes to excess copper in tomato (Lycopersicon esculentum Mill.). Plant Science 127: 129-137.

Mayer, A. M. (2006) Polyphenol oxidases in plants and fungi: going places? a review. Phytochemistry 67: 2318-2331.

Menogeuzzo, S. and Navari-Izzo, F. (1999) Antioxidative responses of shoot and roots of wheat to increasing NaCl concentrations. Plant Physiology 155: 274-280.

Miranda, J. A., Avonce, N., Suarez, R., Thevelein, J. M., Van Dijck, P. and Iturriaga, G. (2007) A bifunctional TPS-TPP enzyme from yeast confers tolerance to multiple and extreme abiotic-stress conditions in transgenic Arabidopsis. Planta 226: 1411-1421.

Mittler, R. (2002) Oxidative stress, antioxidants and stress tolerance. Trends Plant Science 7: 405-410.

Muller, J., Boller T. and Wiemken, A. (1995) Trehalose and trehalase in plants: recent developments. Plant Science 9: 112-119.

Munns, R. (2002) Comparative physiology of salt and water stress. Plant Cell Environment 25: 239-50.

Munns, R. and Tester, M. (2008) Mechanisms of salinity tolerance. Annual Review of Plant Biology 59: 651-681.

Passarakli, M. and Tucker, T. C. (1988) Nitrogen-15 uptake by egg-plant under sodium chloride stress. Soil Science Society 52: 1673-1676.

Pellny, T. K., Ghannoum, O., Conroy, J. P., Schluepmann, H., Smeekens, S., Andralojc, J., Krause, K. P., Goddijn, O. and Paul, M. J. (2004) Genetic modification of photosynthesis with E. coli genes for trehalose synthesis. Plant Biotechnology Journal 2: 71-82.

Pilon-Smits, E. A. H., Terry, N., Sears, T., Kim, H., Zayed, A., Hwang, S., Van Dun, K., Voogd, E., Verwoerd, T. C. and Krutwagen, R. W. (1998) Trehalose-producing transgenic tobacco plants show improved growth performance under drought stress. Plant Physiology 152: 525-532.

Quiroga, M., Guerrero, C., Botella, M. A., Barcelo, A. M., Amaya, I., Medina, M. I., Alonso, F. J., Forchetti, S. M., Tigier, H., and Valpuesta, V. (2000) A tomato peroxidase involved in the synthesis of lignin and subrin. Plant Physiology 122: 1119-1127.

Resende, M. L. V., Nojosa, G. B. A., Cavalcanti, L. S., Aguilar, L. H. C. P., Silva, M. A. G., Perez, J. O., Andrade, G. C. G., Carvalho, G. A. and Castro, R. M. (2002) Induction of resistance in cocoa against crinipellis perniciosa and verticillium dahlia by acibenzolar-s-methyl (ASM). Plant Phsiology 51: 621-628.

Rout, N. P. and Shaw, B. P. (2001) Salt tolerance in aquatic macrophytes: possible involvement of the antioxidative enzymes. Plant Science 160: 415-423.

Sambrook, J. and Russell, D. W. (2001) Molecular Cloning: alaboratory manual. Cold Spring Harbor Laboratory Press, New York.

Schluepmann, H. and Paul, M. (2009) Trehalose metabolism in Arabidopsis: elusive, active and central. In: The Arabidopsis Book 1-7. American Society of Plant Biologists, Rockville, M. D.

Schluepmann, H., Pellny, T., Van Dijken, A., Smeeekens, S. and Paul, M. (2003) Trehalose-6-phosphate is indispensable for carbohydrate utilization and growth in Arabidopsis thaliana. Proceeding of the Natural Academy of Sciences of the United States 100: 6849-6854.

Schluepmann, H., Van Dijken, A., Aghdasi, M., Wobbes, B., Paul, M. and Smeekens, S. (2004) Trehalose mediated growth inhibition of Arabidopsis seedlings is due to Trehalose-6-phosphate accumulation. Plant Physiology 135: 879-890.

Singh, A. K. (2004) The physiology of salt tolerance in four genotypes of chickpea during germination. Journal Agricultural Science Technology 6: 87-93.

Sotirios, A. K., Argyrokastritis, A., Loukas, M., Eliopoulos, E., Tsakas, S. and Kaltsikes, P. (2006) Isolation and characterization of drought related trehalose 6-phosphate-synthase gene from cultivated cotton (Gossypium hirsutum L.). Planta 223: 329-339.

Turhan, E., Karni, L., Aktas, H., Deventurero, G., Chang, D. C., Bar-Tal, A. and Aloni, B. (2006) Apoplastic antioxidants in pepper (Capsicum annuum L.) fruit and their relationship to blossom-end rot. Journal Horticulture and Science Biotechnology 81: 661-667.

Van Dijken, A. J., Schluepmann, H. and Smeekens, S. C.(2004) Arabidopsis trehalose-6-phosphate synthase 1 is essential for normal vegetative growth and transition to flowering. Plant Physiology 135: 969-977.

Wang, W. B., Kim, Y. H., Lee, H. S., Kim, K. Y., Deng, X. P. and Kwak, S. S.(2009) Analysis of antioxidant enzyme activity during germination of alfalfa under salt and drought stresses. Plant Physiology and Biochemistry 47: 570-577.

Wendel, J. F. and Cronn, R. C.(2002) Polyploidy and the evolutionary history of cotton. Advances in Agronomy 87: 139-186.