بررسی اثر تیمارهای سرما و روز کوتاه بر بیان ژن دهیدرین در دانه‏رُست‏ها و شاخسارهای باززایی شده پسته (Pistacia vera L.)

نویسندگان

گروه زیست‌شناسی، دانشکده علوم، دانشگاه شهید باهنر، کرمان، ایران

چکیده

تنش سرما یک عامل محیطی اصلی است که تولید محصولات زراعی را محدود می‏کند. بسیاری از گیاهان می‏توانند از طریق فرآیند عادت به سرما که در نتیجه قرارگیری در معرض طول روزهای کوتاه و دماهای سرد بالای صفر درجه حاصل می‌شود، تحمل به سرما و انجماد را در خود افزایش دهند. پروتئین‏های دهیدرین، در زمان عادت به سرما که باعث آبگیری سلول‏های گیاهی می‏شود، در سلول تجمع کرده، از ساختار غشاها و ماکرومولکول‏ها حفاظت می‏کنند. پسته (Pistacia vera L.) گونه‌ای درختی، شاخص مناطق کویری است که در معرض دماهای گرم و سرد شدید قرار می‏گیرد. در این پژوهش، اثر تیمار سرما و طول روز کوتاه، بر بیان ژن دهیدرین، در دانه‏رُست‏ها و شاخسارهای باززایی شده‏ پسته رقم بادامی بررسی شد. نتایج نشان داد که تیمار سرما بیان ژن را به طور معنی‏داری در سطح 95 درصد، نسبت به شاهد افزایش می‏دهد. هیچ یک از تیمارهای طول روز کوتاه اثری بر بیان ژن دهیدرین نداشت. از آن‏جا که گیاهان باززایی شده ممکن است دچار تنوع سوماکلونال (پیکر تکثیری) شده، پاسخ‏های متفاوتی به تنش‏ها نشان دهند، مقایسه‏ای بین گیاهان رشد کرده در شرایط در زیوه و در شیشه، از نظر میزان بیان این ژن در اثر تیمار یکسان سرمایی، انجام شد. این مقایسه‏ نشان داد که میزان بیان ژن در حالت طبیعی و همچنین پس از تیمار سرما، در گیاهان باززایی شده نسبت به دانه‏رُست‏ها کمتر بود.

کلیدواژه‌ها


عنوان مقاله [English]

Effects of cold and short day treatments on dehydrin gene expression in seedlings and regenerated shoots of pistachio (Pistacia vera L.)

نویسندگان [English]

  • Elaheh Zamani Bahramabadi
  • Farkhondeh Rezanejad
  • Hosseinali Sasan
Department of Biology, Faculty of Sciences, Shahid Bahonar University, Kerman, Iran
چکیده [English]

Cold stress is a major environmental factor that limits the agricultural products. Plants can increase their cold and freezing tolerance by being exposed to short days and cold, non freezing temperatures, a process known as cold acclimation. In the period of cold acclimation that causes dehydration of cells, dehydrin proteins accumulate inside the cells and protect the membranes and macromolecules structure. Pistachio (Pistacia vera L.) is a tree species characteristic of arid zone, which is exposed to extreme temperatures. In this study, the effects of cold and short day treatments on dehydrin gene expression were investigated in seedlings and regenerated shoots of pistachio cultivar Badami. The results showed that cold treatment increased the gene expression meaningfully compaired to the control. The short day treatments had no effect on dehydrin gene expression. Because the regenerated plants may encounter somaclonal variations and thus show different responses to stresses, a comparison was made between in vivo and in vitro grown plants with respect to the rate of gene expression, under similar cold treatment. Comparison of the plants grown in vivo and in vitro showed that dehydrin gene expression was lower in regenerated shoots under natural condition and after cold treatment.

کلیدواژه‌ها [English]

  • Pistachio
  • Dehydrin
  • Short day period
  • Cold acclimation
  • in vitro culture

 

تنش سرما یک عامل محیطی اصلی است که تولید محصولات زراعی را محدود می‏کند و اثر شدیدی بر بقا و توزیع جغرافیایی گیاهان دارد. گیاهان از نظر تحمل دماهای سرد (صفر تا 15 درجه سانتیگراد) و انجماد (کمتر از صفر درجه سانتیگراد) بسیار متفاوتند. بیشتر گیاهان متحمل به سرما هستند؛ گرچه بسیاری از آنها متحمل به انجماد نیستند، با وجود این، می‏توانند از طریق فرآیند عادت به سرما (cold acclimation) که در نتیجه قرارگیری در معرض طول روزهای کوتاه و دماهای سرد بالای صفر درجه حاصل می‌شود، تحمل به سرما و انجماد را در خود افزایش دهند. فرآیند عادت به سرما مستلزم تغییرات بزرگ زیست-‏شیمیایی و عملکردی است (Jan et al., 2009). در زمستان، فعالیت گیاهان چندساله که توانایی عادت به سرما را دارند، در مرحله رویشی متوقف می‎شود. در واقع، گیاهان وارد مرحله خفتگی می‏شوند و تحمل به انجماد در آنها افزایش می‏یابد. به طور معمول، پاسخ گیاه به تنش سرما به سه مرحله مشخص تقسیم می‏شود. نخستین مرحله عادت به سرما (cold acclimation) (پیش از سخت شدن= prehardiness) است که در دماهای سرد بالای دمای انجماد آب رخ می‏دهد. مرحله دوم (سخت شدن=hardiness) به یک دوره قرارگیری در معرض دماهای زیر صفر نیاز دارد و پس از آن میزان کامل تحمل به دست می‏آید. مرحله سوم و پایانی، عادت‏زدایی (deacclimation) و بازگشت گیاه به حالت عادی پس از زمستان است. برخی از گیاهان (به ویژه درختان) به ترکیبی از طول روز کوتاه و سرما نیاز دارند تا تحمل به سرما به طور کامل در آن‏ها ایجاد شود و پس از گرم شدن هوا و طولانی شدن طول روز، تحمل به انجماد در آنها از دست می‏رود (Janska et al., 2010). فرآیند عادت به سرما (مرحله‏ نخست پاسخ گیاه به تنش سرما) شامل دو مرحله مشخص است. در ابتدا کاهش طول روز باعث توقف رشد و ایجاد خفتگی می‏شود و افزایش حدواسطی در تحمل به انجماد دیده می‏شود. سپس، در مرحله دوم با قرارگیری گیاه در معرض دماهای سرد و سپس دماهای انجماد، بیشینه تحمل به انجماد در گیاهان به دست می‏آید و بخش‏های ماندگار در زمستان قادر به بقا در دماهای انجماد می‏شوند (Puhakainen et al., 2004). پسته خوراکی (Pistacia Vera) از گونه‌های مهم جنس Pistacia L. است. این جنس متعلق به تیره Anacardiaceae و راسته‌ Sapindales است. P. vera تنها گونه‏ مهم از نظر اقتصادی در جنس Pistacia L. است و در مناطق گرمسیری دنیا به خاطر دانه خوراکی‏اش کشت می‏شود. پسته گونه‌ای درختی، شاخص مناطق کم آب است که در معرض خشکی و دماهای گرم و سرد شدید قرار می‏گیرد (Tilkat and Onay, 2008). پروتئین‎های دهیدرین یعنی گروه
(D-11) از پروتئین‏های LEA (Late embryogenesis ebundant) در اعضای مختلفی از قلمرو گیاهان مانند گیاهان غیر‌آوندی، گیاهان آوندی بدون دانه و به طور عمومی‎تر در همه گیاهان دانه‎داری که بررسی شده‌اند، شناسایی شده است. مطالعات نشان داده است که این پروتئین‎ها به شکل بسیار آب‎دار، بدون ساختار و بی‎نظم در محلول آبی قرار دارند و در زمان تنش‏هایی که باعث آب‏گیری سلول می‏شوند (مانند سرما، خشکی، شوری و ...) از غشاها و ماکرومولکول‏های سلول حفاظت می‎کنند (Battaglia et al., 2008). توالی ناحیه‏ کد کننده‏ ژن دهیدرین پسته (PV-dhn) توسط Yakubov و همکاران (2005) شناسایی شد. ژن دهیدرین پسته cDNA ای با bp 874 جفت باز و یک ORF (Open reading frame) با bp 690 دارد که پروتئینی با 230 اسید آمینه را کد می‏کند و احتمالاً ژنی تک نسخه‏ای در ژنوم پسته است. پروتئین دهیدرین پسته وزنی حدود 9/25 کیلودالتون دارد. دهیدرین پسته از نوع K5 است (Yakubov et al., 2005). با توجه به اثر درخور توجه تنش سرما بر گیاهان و همچنین، آثار مخرب این تنش بر گیاه پسته که از صادرات مهم غیر نفتی ایران است، بررسی سازوکارهای درگیر در فرآیند عادت به سرما و پاسخ به این تنش می‏تواند مهم باشد. هدف این پژوهش، این است که تأثیر تیمارهای سرما و طول روز کوتاه بر بیان ژن دهیدرین، در برگ دانه‏رُست‏های پسته بررسی شود و مشخص شود که آیا ژن دهیدرین پسته در اثر سرما، طول روز یا هر دوی آنها در زمستان بیان می‏شود، همچنین، مشخص شود که آیا این ژن علاوه بر اندام‏های ماندگار در زمستان، در اندام غیر ماندگار مانند برگ نیز عملکردی هست یا خیر. از آن‏ جا که گیاهان باززایی شده ممکن است پاسخ‏های متفاوتی به تنش‏ها ارایه دهند، مقایسه‏ای بین گیاهان رشد کرده در شرایط در زیوه (in vivo) و در شیشه (in vitro)، از نظر میزان بیان این ژن در اثر تیمارهای یکسان انجام شود.

 

مواد و روش‌ها

کشت گیاهان در گلخانه

بذرهای پسته رقم بادامی از مؤسسه تحقیقات پسته کشور در رفسنجان تهیه شدند. بذرها به مدت 1 دقیقه در محلول (WV-1) 1000/1 قارچ‏کش بنومیل ضدعفونی شدند، سپس به مدت 24 ساعت در آب خیسانده، در گلدان‏های حاوی مخلوط 1:1 از خاک و ماسه کاشته شدند. گلدان‏ها در شرایط گلخانه با حرارت روز و شب 23-25 درجه سانتیگراد و تحت نور 2000 لوکس با دوره نوری 16 ساعت روشنایی و 8 ساعت تاریکی قرار گرفته، یک روز در میان آبیاری شدند.

کشت گیاهان در شیشه

محیط‌کشت مورد استفاده، محیط‌کشت پایه MS (Murashige and Skoog, 1962) همراه با 30 گرم در لیتر سوکروز، 8 گرم در لیتر آگار، مقدار
mgl-1 2,4-D 25/0mgl-1 BAP+ 3 و ویتامین‏ها بود. اسیدیته محلول در حد 8/5-9/5 تنظیم و محلول حاصل به مدت 20 دقیقه در دمای 121 درجه سانتیگراد و فشار 2 اتمسفر اتوکلاو شد. قطعات تک‎گره به اندازه حدود 1 سانتی‎متر از گیاهان گلخانه‎ای یک ماهه‏ به دست آمدند. برای ضدعفونی کردن، جداکشت‎ها به مدت 45 ثانیه در الکل 70 درصد غوطه‎ور شدند و پس از شستشو با آب مقطر استریل به مدت 25 دقیقه در محلول هیپوکلرید سدیم 5 درصد همراه با4 قطره تویین 20 قرار گرفتند. جداکشت‎ها 3 تا 4 بار با آب مقطر استریل شسته و روی محیط‌کشت قرار گرفتند. نمونه‏‎ها در اتاق رشد در دمای 23-25 درجه سانتیگراد و تحت نور 2000 لوکس و دوره‏ نوری 16 ساعت روشنایی و 8 ساعت تاریکی قرار گرفتند و هر 2 هفته یک‌بار واکشت شدند.

تیمارها

به منظور انجام تیمار سرما، دانه‏رُست‏ها و شاخسار‏های باززایی شدة‏ یک ماهه به مدت‏های 1، 3، 7 و 14 روز در دمای 4 درجه سانتیگراد و دوره نوری 16 ساعت روشنایی و 8 ساعت تاریکی قرار داده شدند. به منظور انجام تیمار طول روز کوتاه، دانه‏رُست‏ها و شاخسارهای باززایی شدة‏ یک ماهه به مدت‏های 1، 3، 7 و 14 روز در دوره نوری 16 ساعت روشنایی و 8 ساعت تاریکی و دمای 25 درجه سانتیگراد قرار داده شدند.

طراحی آغازگر

توالی ناحیه کد کننده ژن‏های دهیدرین پسته به عنوان ژن پاسخگو (accession no: Y07600) و ژن NADH dehydrogenase،(accession no: HM991263) پسته به عنوان ژن مرجع (reference gene) از سایت NCBI گرفته شد و طراحی آغازگرها با استفاده از نرم‏افزار Primer3 انجام شد و سپس مناسب بودن آنها توسط نرم‏افزارهای BLAST و GeneRunner بررسی شد. توالی آغازگرهای طراحی شده به صورت زیر است، پس از آن، سنتز آغازگرهای طراحی شده توسط شرکت سیناژن انجام شد.

 

Dehydrin Forward 2:
5’ ATGGATATGGCGTAGAGAAG 3’ TM: 52
Dehydrin Reverse 2:
5’ TACTTGGGATCTCATTCACC 3’ TM: 52
Product size: 156 bp
 

NADH dehydrogenase Forward:
5’ GGAGACTCAAATGGTGGATA 3’ TM: 55

NADH dehydrogenase Reverse:
5’ ACCTGCTAGTGGAGGAAGAC 3’ TM: 55

Product size: 216 bp

 

مطالعات بیان ژن

RNA کل از برگ گیاهان شاهد و تیمار با استفاده از کیت استخراج RNA،(Qiagene, RNeasy Plant Mini Kit, Germany) طبق روش مندرج در کیت استخراج شد. برای بررسی حضور، ارزیابی خلوص و تعیین غلظت RNA از روش‏های اسپکتروفتومتری با استفاده از زیست‌سنج نوری مدل 6131 (Eppendorf AG Biophotometer, Germany) و الکتروفورز افقی روی ژل آگاروز 1 درصد استفاده شد. برای انجام
RT-PCR، از RNA استخراج شده از همه گیاهان شاهد و تیمار به مقدار مساوی (600 نانوگرم) برداشته شد و برای هر نمونه (شاهد و تیمارها) دو لوله در نظر گرفته شد که در یکی از آنها آغازگرهای ژن دهیدرین و در لوله دیگر، به عنوان شاهد داخلی (internal control)، آغازگرهای ژن NADH dehydrogenase ریخته شد. برای انجام RT-PCR از کیت RT-PCR یک مرحله‏ای، (BIONEER, AccuPowerR RT/PCR PreMix, Korea) طبق روش مندرج در کیت و ترموسایکلر مدل PTC،(MJ Mini Personal Termal Cycler BioRad, USA 1148)، استفاده شد. لوله‏های لیوفیلیزه موجود در کیت دارای تمامی مواد لازم برای سنتز cDNA و انجام PCR هستند. برنامه استفاده شده برای انجام واکنش PCR در جدول 1 آورده شده است:

 

جدول 1- برنامه اجرا شده در PCR به وسیله آغازگرهای سنتزکننده‏ قطعه‏ 156 جفت بازی از ژن دهیدرین و قطعه‏ 216 جفت بازی از ژن مرجع. دمای اتصال آغازگرها برای ژن دهیدرین 52 و برای ژن مرجع 55 است.

زمان
(دقیقه)

حرارت
(°C)

مرحله

تعداد سیکل

5

94

واسرشت‌سازی اولیه

1

1

94

واسرشت‌سازی

30

1

52 و 55

اتصال آغازگرها

1

72

طویل شدن زنجیره DNA

7

72

طویل شدن نهایی

1

 

تحلیل داده‏ها

شدت باند تکثیر شده در واکنش PCR با استفاده از نرم‌افزار Totallab به دست آمد. سپس داده‏های مربوط به شدت باندها برای مقایسه میزان بیان ژن بین نمونه‏های شاهد و تیمار، با استفاده از آزمون چند دامنه‏ای دانکن توسط نرم‌افزار SPSS نسخه 5/11 و با ضریب اطمینان 95 درصد مقایسه و نمودارها با استفاده از نرم‌افزار Excel نسخه 2007 ترسیم شدند. در آزمایش‌ها،
RT-PCR سه تکرار در نظر گرفته شد.

 

نتایج

RNA کل

نتایج حاصل از خواندن جذب RNA استخراج شده نشان داد که جذب RNA‌ها در طول موج 260 نانومتر به طور متوسط 06/0-07/0 بود. حضور سه باند پُر رنگ که به RNAهای ریبوزومی که نشان‌دهنده‏ کیفیت مطلوب RNA استخراج شده برای انجام RT-PCR مربوط است، روی ژل آگاروز مشاهده شد (شکل 1).

 

 

شکل 1- نیم‏رخ الکتروفورزی یکی از نمونه‏های (7 روز تیمار سرما) RNA کل استخراج شده از برگ پسته روی ژل آگاروز 1 درصد. M: نشانگر مولکولی (1kb DNA ladder, Fermentase).


بیان ژن دهیدرین در دانه‌رُست‏های پسته

نتایج حاصل از RT-PCR، تکثیر قطعه 156 جفت بازی را برای ژن دهیدرین و قطعه 216 جفت بازی را برای ژن مرجع نشان داد (شکل‏های 2 و 3). داده‏های مربوط به شدت باندها که از نرم‌افزار Totallab (نسخه Phoretix 1D) به دست آمده بودند، نشان دادند که میزان بیان ژن مرجع در همه گیاهان شاهد و تیمار یکسان بود. همچنین، نشان داده شد که میزان بیان ژن دهیدرین تحت همه‏ تیمارهای سرمایی (1، 3، 7 و 14 روز) نسبت به گیاه شاهد افرایش معنی‏داری داشت، با این حال، تفاوتی در میزان بیان ژن تحت تیمارهای مختلف سرمایی دیده نشد. هیچ یک از تیمارهای طول روز کوتاه استفاده شده در این تحقیق (1، 3، 7 و 14 روز) اثری بر بیان ژن دهیدرین نداشتند (شکل‏های 2، 3 و 4).

 

 

 

شکل 2- نیم‏رخ الکتروفورزی باندهای حاصل از واکنش RT-PCR قطعه 216 جفت بازی، با استفاده از آغازگرهای ژن مرجع. M: نشانگر مولکولی (Vivantice DNA ladder)؛ C: شاهد؛ SD1: 1 روز طول روز کوتاه؛ LT1: 1 روز سرما؛ SD3: 3 روز طول روز کوتاه؛ LT3: 3 روز سرما؛ SD7: 7 روز طول روز کوتاه؛ LT7: 7 روز سرما؛ SD14: 14 روز طول روز کوتاه؛ LT14: 14 روز سرما؛ (SD: short day, LT: low temperature).

 

شکل 3- نیم‏رخ الکتروفورزی باندهای حاصل از واکنش RT-PCR قطعه 156 جفت بازی، با استفاده از آغازگرهای ژن دهیدرین. M: نشانگر مولکولی (Vivantice DNA ladder)؛ C: شاهد؛ SD1: 1 روز طول روز کوتاه؛ LT1: 1 روز سرما؛ SD3: 3 روز طول روز کوتاه؛ LT3: 3 روز سرما؛ SD7: 7 روز طول روز کوتاه؛ LT7: 7 روز سرما؛ SD14: 14 روز طول روز کوتاه؛ LT14: 14 روز سرما؛ (SD: short day, LT: low temperature).

 

 

شکل 4:- میزان بیان ژن دهیدرین در دانه‏رُست‏های شاهد و تیمارهای 1، 3، 7 و 14 روز سرما. میزان بیان ژن در اثر تیمارهای سرمایی افزایش معنی‏داری نسبت به شاهد دارد و در اثر تیمارهای طول روز کوتاه نسبت به شاهد تفاوتی نشان نمی‏دهد. C: شاهد؛ SD1: 1 روز طول روز کوتاه؛ LT1: 1 روز سرما؛ SD3: 3 روز طول روز کوتاه؛ LT3: 3 روز سرما؛ SD7: 7 روز طول روز کوتاه؛ LT7: 7 روز سرما؛ SD14: 14 روز طول روز کوتاه؛ LT14: 14 روز سرما؛ (SD: short day, LT: low temperature). حروف یکسان بیانگر عدم اختلاف معنی‏دار بین میانگین‏ها بر اساس آزمون چند دامنه‏ای دانکن در سطح P<0.05 است.

 

 

بیان ژن دهیدرین در شاخسارهای باززایی شده‏ پسته

به منظور بررسی بیان ژن دهیدرین در شاخسارهای باززایی شده، از برگ شاخسارهای باززایی شده‏ شاهد و تیمارهای 7 روز سرما و 7 روز طول روز کوتاه، RNA کل استخراج و RT-PCR انجام شد. نتایج نشان داد که میزان بیان ژن مرجع در همه‏ گیاهان شاهد و تیمار یکسان بود و میزان بیان ژن دهیدرین تحت تیمار سرمایی نسبت به گیاه شاهد افزایش معنی‏داری داشت و در این‏جا نیز طول روز کوتاه اثری بر بیان ژن دهیدرین نداشت (شکل‏های 5، 6 و 7).

مقایسه اثر سرما بر دانه‏رُست‏ها و شاخسارهای باززایی شده

به منظور مقایسه اثر سرما بر بیان ژن دهیدرین در دانه‏رُست‏ها و شاخسارهای باززایی شده‏، از برگ دانه‏رُست‏ها و شاخسارهای باززایی شده‏‏ شاهد و آنهایی که 7 روز تیمار سرما دیده بودند، RNA کل استخراج و RT-PCR انجام شد. نتایج نشان داد که میزان بیان ژن مرجع در همه نمونه‏ها یکسان بود و شاخسارهای باززایی شده نسبت به دانه‏رُست‏ها، هم در حالت طبیعی و هم پس از تیمار سرما، کمتر قادر به بیان ژن دهیدرین بودند (شکل‏های 8، 9 و 10).

 

 

شکل 5- نیم‏رخ الکتروفورزی باندهای حاصل از واکنش RT-PCR قطعه 216 جفت بازی، با استفاده از آغازگرهای ژن مرجع. M: نشانگر مولکولی (Vivantice DNA ladder)؛ C: شاهد؛ SD7: 7 روز طول روز کوتاه؛ LT7: 7 روز سرما؛ (SD: short day, LT: low temperature).

 

شکل 6- نیم‏رخ الکتروفورزی باندهای حاصل از واکنش RT-PCR قطعه 156 جفت بازی، با استفاده از آغازگرهای ژن دهیدرین. M: نشانگر مولکولی (Vivantice DNA ladder)؛ C: شاهد؛ SD7: 7 روز طول روز کوتاه؛ LT7: 7 روز سرما؛ (SD: short day, LT: low temperature).

 

شکل 7- میزان بیان ژن دهیدرین در شاخسارهای باززایی شده‏ی شاهد و تیمارها 7 روز سرما و 7 روز طول روز کوتاه. میزان بیان ژن در اثر تیمار سرما افزایش معنی‏داری نسبت به شاهد دارد و در اثر تیمار طول روز کوتاه نسبت به شاهد تفاوتی نشان نمی‏دهد. C: شاهد؛ SD7: 7 روز طول روز کوتاه؛ LT7: 7 روز سرما؛ (SD: short day, LT: low temperature). حروف یکسان بیانگر عدم اختلاف معنی‏دار بین میانگین‏ها بر اساس آزمون چند دامنه‏ای دانکن در سطح P<0.05 است.

 

 

 

 

 

شکل 8- نیم‏رخ الکتروفورزی باندهای حاصل از واکنش RT-PCR قطعه 216 جفت بازی، با استفاده از آغازگرهای ژن مرجع. M: نشانگر مولکولی (Vivantice DNA ladder)؛ SLT: 7 روز تیمار سرما در دانه‏رُست؛ TLT: 7 روز تیمار سرما در شاخسارهای باززایی شده؛ SC: شاهد دانه‏رُست؛ TC: شاهد شاخسار باززایی شده؛ (SLT: seedling low temperature, TLT: tissue culture low temperature, SC: seedling control, TC: tissue culture control).

 

شکل 9- نیم‏رخ الکتروفورزی باندهای حاصل از واکنش RT-PCR قطعه 156 جفت بازی، با استفاده از آغازگرهای ژن دهیدرین. M: نشانگر مولکولی (Vivantice DNA ladder)؛ SLT: 7 روز تیمار سرما در دانه‏رُست؛ TLT: 7 روز تیمار سرما در شاخسارهای باززایی شده؛ SC: شاهد دانه‏رُست؛ TC: شاهد شاخسار باززایی شده؛ (SLT: seedling low temperature, TLT: tissue culture low temperature, SC: seedling control, TC: tissue culture control).

 

شکل 10- میزان بیان ژن دهیدرین در دانه‏رُست‏ها و شاخسارهای باززایی شده‏ شاهد و تیمار 7 روز سرما. SLT: 7 روز تیمار سرما در دانه‏رُست؛ TLT: 7 روز تیمار سرما در شاخسارهای باززایی شده؛ SC: شاهد دانه‏رُست؛ TC: شاهد شاخسار باززایی شده. حروف یکسان بیانگر عدم اختلاف معنی‏دار بین میانگین‏ها بر اساس آزمون چند دامنه‏ای دانکن در سطح P<0.05 است. (SLT: seedling low temperature, TLT: tissue culture low temperature, SC: seedling control, TC: tissue culture control).

 

 

بحث

بیان طبیعی ژن دهیدرین در گیاهان

میزان پروتئین دهیدرین در سلول‏های گیاهان چوبی همراه با تغییرات فصلی تغییر می‏کند. در گیاهان چوبی مانند غان و هلو نشان داده شده است که میزان پروتئین دهیدرین با شروع پاییز، شروع به افزایش می‏کند و در اواسط زمستان که گیاه عادت به سرما کرده است، به بیشینه رسیده، در اواخر بهار همراه با عادت‏زدایی، کاهش می‏یابد (Yakubov et al., 2005). Yakubov و همکاران (2005) نشان دادند که پروتئین دهیدرین پسته نیز در جوانه‏های گل‏آذین نر چنین تغییرات فصلی را نشان می‏دهد. Rorat و همکاران (2004) اظهار داشتند که دهیدرین‏ها به طور تقریبی در همه بافت‎های رویشی، در زمان رشد بهینه، بیان پایینی داشته و در سلول‎ها حضور دارند. Richard و همکاران (2000) نشان دادند که در حالت طبیعی، در میزان رونوشت ژن دهیدرین بین اندام‏های مختلف گیاهان تفاوت‏هایی وجود. همچنین، Wisniewski و همکاران (1996) نشان داده‏اند که ممکن است چندین نوع دهیدرین در یک گیاه وجود داشته باشد که برخی به طور فصلی و برخی به طور دامی و ثابت بیان می‏شوند و همچنین، بعضی از دهیدرین‏ها تنها در برخی از اندام‏ها بیان می‏شوند. گزارش‏های محدودی در مورد بیان ژن دهیدرین در برگ‏ها وجود دارد، اما Puhakainen و همکاران (2004) نشان دادند که مسیرهای انتقال پیامی که باعث تحمل به انجماد در بافت‏های ماندگار در زمستان مانند ساقه و جوانه‏ها‏ی غان نقره‏ای (Betula pendula cv Roth) می‏شوند، در برگ‏های این گیاه نیز بیان می‌شوند. این محققان اظهار داشتند که برگ می‏تواند مدل خوبی برای بررسی وقایع مولکولی که در طول فرآیند عادت به سرما رخ می‏دهند، باشد. در این تحقیق نیز برگ به عنوان اندام مورد مطالعه انتخاب شد. نتایج RT-PCR نشان داد که ژن دهیدرین پسته در شرایط طبیعی یعنی شرایط گلخانه‏ای با طول روز بلند و دمای اتاق، میزان پایینی از بیان را در برگ دانه‏رُست‏ها داشت.

بیان ژن دهیدرین در اثر تنش‏های غیر زیستی مانند سرما

گیاهان در طول زندگی در معرض انواعی از تنش‏های محیطی قرار می‏گیرند. آب‏گیری سلول، وجه مشترک تنش‏های غیر زیستی مانند سرما، خشکی و شوری است و بسیاری از ژن‏های پاسخگو به سرما، توسط این تنش‏ها نیز القا می‏شوند (Puhakainen et al., 2004). در گیاهانی که در معرض آب‎گیری قرار گرفته‎اند سمیّت فلزی همراه با تولید گونه‎های اکسیژن آزاد امری عمومی است و دهیدرین‎ها می‎توانند به عنوان نظافتچی‎های رادیکال‎های آزاد حاصل از تنش اکسیداتیو عمل کنند. اتصال به فلز که از ویژگی‏های پروتئین‏های دهیدرین است، ممکن است با عملکرد سمّ‎زدایی مورد نیاز تحت شرایط تنش مرتبط باشد (Battaglia et al., 2008). همچنین، شواهدی وجود دارد که دهیدرین‎ها از غیرفعال‎ شدن آنزیم‎ها که در اثر آب‎گیری اتفاق می‌افتد، جلوگیری می‎کنند که این عمل به برهم‎کنش این‎ پروتئین‏ها با سطوح آب‎گریز غشاها و پروتئین‎هایی که در حال واسرشت شدن هستند، وابسته است (Hara et al., 2001). به علاوه، مارپیچ‌های α و ساختار بی‏نظم دهیدرین‏ها در فراهم کردن یا حفظ آب در محیط‏های ریز سلولی برای حفظ عملکرد و تثبیت ساختار ماکرومولکول‏ها و ساختارهای سلولی در زمان کمبود آب نقش مهمی دارند (Battaglia et al., 2008). هورمون ABA در مسیرهای انتقال پیام بسیاری از ژن‏های پاسخگو به تنش دخیل است و در نتیجه بیان این ژن‏ها در اثر ABA خارجی نیز القا می‏شود (Puhakainen et al., 2004).

پژوهش‌های بسیاری حاکی از آن است که ژن دهیدرین گیاهان در پاسخ به شرایط محیطی که باعث آب‏گیری می‏شوند، بیان می‏شود. مطالعات زیادی روی گیاهان چوبی، افزایش بیان ژن‏های مختلف دهیدرین را تحت تنش سرما، خشکی ، شوری، تیمار با ABA خارجی، پلی‏اتیلن‏گلیکول، جاسمونات و متیل جاسمونات و همچنین پس از زخم به طور قطعی بیان کرده‏اند (Yakubov, 2005). در این پژوهش نیز بیان ژن دهیدرین پس از تنش‏های سرمایی، افزایش پیدا کرد که با گزارش‌هایی که روی سایر گیاهان انجام شده‌اند، همخوانی دارد. با افزایش طول دوره‏ سرما از 1 تا 14 روز افزایش بیشتری در بیان ژن دیده نشد، گرچه ممکن است با افزایش طول دوره‏ سرما بیان اندکی افزایش پیدا کرده باشد، با وجود این، ممکن است افزایش آنقدر اندک باشد که در آزمایش نشان داده ‏نشده است و ممکن است با افزایش بیشتر طول دوره‏ تیمار که به تدریج باعث آب‌گیری بیشتری از سلول‏ها می‏شود، افزایش معنی‏داری دیده شود.

بیان ژن دهیدرین در اثر تغییر طول روز

فرآیند عادت به سرما شامل دو مرحله مشخص است. در ابتدا، کاهش طول روز باعث توقف رشد و ایجاد خفتگی می‏شود و افزایش حدواسطی در تحمل به انجماد به دست می‏آید. سپس، در مرحله دوم با قرارگیری گیاه در معرض دماهای سرد و سپس دماهای انجماد بیشینه تحمل به انجماد در گیاهان به دست می‏آید و بخش‏های ماندگار در زمستان قادر به بقا در دماهای انجماد می‏شوند (Puhakainen et al., 2004). فیتوکروم‏ها، حسگرهای نوری مسؤول درک طول روز در گیاهان هستند. درک تغییرات نوری توسط این گیرنده‏ها مسیرهای انتقال پیامی را در سلول‏ها فعال می‏کند که سبب تغییر در بیان برخی ژن‏ها شده، پاسخ‏های عملکردی و نموی به میزان نور داده می‏شود (Welling et al., 2002). گزارش‏هایی درباره‏ افزایش بیان ژن دهیدرین در اثر کوتاه شدن طول روز به تنهایی وجود دارد Welling et al., 2002)؛ Marian et al., 2004؛ Puhakainen et al., 2004؛ Welling et al., 2004؛ (Wisniewski et al., 2006. طول روز کوتاه نیز باعث آب‏گیری متوسطی از سلول‏ها به ویژه سلول‏های جوانه‏ها می‏شود که این آب‏گیری ممکن است نتیجه‏ تجمع موادی مانند پروتئین‏ها و کربوهیدرات‏ها باشد (Welling et al., 2002). نتایج این محققان نشان داد که طول روز کوتاه و سرما، از دو مسیر مستقل افزایش بیان دهیدرین را القا می‏کنند. Puhakainen و همکاران (2004) اظهار داشتند که طول روز کوتاه به تنهایی تأثیر بسیار اندکی بر بیان ژن دهیدرین در برگ‏های غان نقره‏ای داشت، اما سلول‏ها را برای درک بعدی سرما حساس‏تر کرد و بیان ژن دهیدرین در گیاهانی که پیش از تیمار سرما، مدتی در شرایط طول روز کوتاه قرار گرفته بودند نسبت به گیاهانی که تنها تیمار سرما دیده بودند، بسیار بالاتر بود. این اثر همیارانه‏ (synergistic effect) طول روز کوتاه و سرما، گیاه را به سختی بیشینه در زمستان می‏رساند.

در این پژوهش، اثر تیمار طول روز کوتاه روی برگ پسته بررسی شد، اما حتی 14 روز پس از تیمار نیز افزایشی در میزان بیان ژن دهیدرین دیده نشد. ممکن است طول دوره‏ تیمار (بیشینه 14 روز) به اندازه کافی زیاد نبوده تا تغییری در میزان بیان ایجاد شود. همان‌طور که Welling و همکاران (2002) نشان دادند که بیان دهیدرین در صنوبر دورگه (Populus tremula × Populus tremuloides Michx) پس از 21 روز از تیمار روز کوتاه اندکی افزایش پیدا کرد، گرچه در تحقیق Puhakainen و همکاران (2004) حتی یک روز تیمار روز کوتاه، بیان ژن دهیدرین غان را اندکی افزایش داد. همچنین، ممکن است که افزایش بیان به حدی پایین بوده که در آزمایش نشان داده نشده است و ممکن است با افزایش طول دوره‏ تیمار که به تدریج باعث آب‏گیری بیشتری از سلول‏ها می‏شود، افزایش معنی‏داری دیده شود. همچنین، ممکن است که این ژن دهیدرین (PV-dhn) که تنها ژن دهیدرین شناخته شده در پسته است، تنها از طریق پاسخ به سرما موجب عادت به سرما می‏شود و پاسخگو به طول روز نیست. همان‌طور که Wisniewski و همکاران (2006) نشان دادند که یکی از ژن‏های دهیدرین هلو (Pronus persica)، به نام Ppdhn1 در اثر سرما و خشکی، و ژن دهیدرین دیگر آن Ppdhn2 تنها با خشکی بیان می‏شوند و طول روز کوتاه روی بیان هیچ یک از آنها تأثیری ندارد. همچنین، Marian و همکاران (2004) نشان دادند که از سه ژن دهیدرین Rhododendron، تنها یکی از آنها پاسخگو به هر دو عامل سرما و طول روز است و دو ژن دیگر تنها توسط پاسخ به سرما باعث عادت به سرما می‏شوند و طول روز روی بیان آنها اثری ندارد.

تفاوت بیان ژن دهیدرین در اثر سرما بین گیاهان گلخانه‏ای و گیاهان در شیشه

روش‎های کشت در شیشه به روش‎های سنتی پرورش گیاه برای تغییر و پیشرفت گیاهان کمک زیادی کرده‎اند. از دهه 1940 مشخص شد که کشت بافت باعث تولید رقم‎هایی از طریق عادت‎دهی و ایجاد تنوع سوماکلونال می‎شود و از اوایل دهه 1970 این روش برای تولید گیاه با ویژگی‎های بهتر استفاده شد. این تنوع سوماکلونال در گیاهکهای باززایی شده دیده می‎شود و ممکن است از قبل در سلول‎ها وجود داشته، یا از طریق کشت القا شده باشد. این تنوع ممکن است ژنتیک یا اپی‎ژنتیک باشد. تغییرات در گیاهک‎های باززایی شده توانایی زیادی برای کمک به کشاورزی و زراعت دارد، اما این توانایی هنوز در سطح وسیع استفاده نشده است. در کشت در شیشه ممکن است انواعی از سلول‎های جهش ‎یافته تولید شوند که تفاوت‎های مفیدی مانند مقاومت به تنش، مقاومت به علف‎کش و مقاوت به آنتی‎بیوتیک نشان دهند. به ‎هر حال، باززایی گیاهان با ویژگی‎های مطلوب در موارد محدودی گزارش شده است (Thorpe, 2007). در این مطالعه، در دانه‏رُست‏ها و شاخسارهای باززایی شده‏ پسته، میزان بیان ژن در اثر تیمار سرما افزایش معنی‏داری نسبت به شاهد دارد. اما میزان بیان ژن در شاخسارهای باززایی شده هم در حالت طبیعی (شاهد) و هم پس از تیمار سرما کمتر از بیان ژن در دانه‏رُست‏ها است، یعنی برگ شاخسارهای پسته باززایی شده در شیشه، در حالت طبیعی، تا حدودی کمتر از برگ گیاهان رشد کرده در زیوه، ژن دهیدرین را بیان می‏کردند که علت آن می‏تواند رطوبت بالای شرایط در شیشه و یا حتی حذف اثر شوری روی بیان این ژن باشد که این شرایط ایده‏آل برای دانه‏رُست‏های رشد کرده در خاک ممکن است فراهم نباشد. گرچه شاخسارهای در شیشه نیز مانند گیاهان گلخانه‏ای، پس از تیمار سرما قادر به افزایش بیان ژن دهیدرین بودند اما پس از تیمار نیز میزان بیان ژن در شاخسارهای در شیشه‏ نسبت به گیاهان گلخانه‏ای که تیمار مشابهی دیده بودند، کمتر بود که علت آن می‏تواند پایین‌تر بودن بیان در حالت عادی در شاخسارهای در شیشه باشد، می‏توان احتمال داد که با افزایش طول دوره یا پایین آوردن دمای تیمار سرما، میزان بیان ژن در شاخسارهای در شیشه به سطح دانه‏رُست‏ها برسد.

مطالعات مروری در این تحقیق گزارشی درباره‏ مقایسه بیان ژن دهیدرین بین گیاهان در شیشه و گیاهان رشد کرده در شرایط عادی نشان نداد. به هر حال، Palonen و همکاران (2000) نشان دادند که پس از تیمار سرما، شاخسارهای در شیشه‏ی تمشک (Rubus idaeus L.) نسبت به گیاهان رشد کرده در زیوه، کمتر قادر به افزایش کربوهیدرات‏های محلول (که در زمان عادت به سرما، در سلول‏ها افزایش می‏یابد) در سلول‏ها بودند و LT50 (دمایی که در آن مرگ گیاهان در اثر تنش، 50 درصد است) مشاهده شده در گیاهان در شیشه بالاتر از LT50 گیاهان رشد کرده در زیوه بود. همچنین، Guy و همکاران (1987) نشان دادند که گیاهان اسفناج (Spinacia oleracea L.) رشد کرده در شیشه مانند گیاهان رشد کرده در خاک، پس از قرارگیری در معرض تیمار سرما، قادر به عادت به سرما بودند و تحمل به انجماد خود را افزایش دادند، اما میزان تحمل به دست آمده در آنها تا حدودی کمتر از گیاهان رشد کرده در خاک بود.

 

 

 

 

 

Battaglia, M., Olvera-Carrillo, Y., Garciarrubio, A., Campos, F. and Covarrubias, A. (2008) The enigmatic LEA proteins and other hydrophilins. Plant Physiology 148: 6-24.

Guy, C. L., Hummel, R. L. and Haskell, D. (1987) Induction of freezing tolerance in spinach during cold acclimation. Plant Physiology 84: 868-871.

Hara, M., Terashima, S. and Kuboi, T. (2001) Characterization and cryoprotective activity of cold-responsive dehydrin from Citrus unshiu. Plant Physiology 58: 1333-1339.

Jan, J., Mahboob-ul-Hussain, and Andrabi, K. (2009) Cold resistance in plants: a mystery unresolved. Electronic journal of biotechnology 12(3):1-15.

Janska, A., Marsik, P., Zelenkova, S. and Ovesna, J. (2010) Cold stress and acclimation- What is important for metabolic adjustment? Plant Biology 12: 395-405.

Marian, C., Eris, A., Krebs, S. and Arora, R. (2004) Environmental regulation of a 25 kDa dehydrin in relation to Rhododendron cold acclimation. Journalof American Society for Horticultural Science 129: 354-359.

Murashige, T. and Skooge, F. (1962) A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiologia Plantarum 15: 473-497.

Palonen, P., Buszard, D. and Donnelly, D. (2000) Changes in carbohydrates and freezing tolerance during cold acclimation of red raspberry cultivars grown in vitro and in vivo. Physiologia Plantarum 110: 393-401.

Puhakainen, T., Li, C., Boije-Malm, M., Kangasjarvi, J., Heino, P. and Palva, T. (2004) Short-day potentiation of low temperature-induced gene expression of a C-repeat-binding factor-controlled gene during cold acclimation in silver birch. Plant Physiology 136: 4299-4307.

Richard, S., Morency, M. J., Drevet, C., Jouanin, L. and Seguin, A. (2000) Isolation and characterization of a dehydrin gene from white spruce induced upon wounding, drought and cold stress. Plant Molecular Biology 43: 1-10.

Rorat, T., Grygorowicz, W. J., Irzykowski, W. and Rey, P. (2004) Expression of KS-type dehydrins is primarily regulated by factors related to organ type and leaf developmental stage during vegetative growth. Planta 218: 878-885.

Thorpe, T. A. (2007) History of plant tissue culture. Molecular Biotechnology 37: 169-180.

Tilkat, E. and Onay, A. (2008) Direct shoot organogenesis from in vitro-derived mature leaf explants of pistachio. In Vitro Cellular and Developmental Biology-Plant 45: 92-98.

Welling, A., Moritz, T., Palva, T. and Junttila, O. (2002) Independent activation of cold acclimation by low temperature and short photoperiod in hybrid aspen. Plant Physiology 129: 1633-1641.

Welling, A., Rinne, P., Vihera-Aarnio, A., Kontunen-Soppela, S., Heino, P. and Palva, T. (2004) Photoperiod and temperature differentially regulate the expression of two dehydrin genes during overwintering of birch (Betula pubescens Ehrh.). Journal of Experimental Botany 55: 507-516.

Wisniewski, M., Bassett, C., Renaut, J., Farrell, R., Tworkoski, T. and Artlip, T. (2006) Ddifferential regulation of two dehydrin genes from peach (Pronus persica) by photoperiod, low temperature and water deficit. Tree Physiology 26: 575-584.

Wisniewski, M., Close, T. J., Artlip, T. and Arora, A. (1996) Seasonal patterns of dehydrins and 70-kDa heat shock proteins in bark tissues of eight species of woody plants. Physiologia Plantarum 96: 496-505.

Yakubov, B., Barazani, O., Shachack, A., Rowland, L. J., Shoseyov, O. and Golan-Goldhirsh, A. (2005) Cloning and expression of a dehydrin-like protein from Pistacia vera L. Trees 19: 224-230.