OsABI5 و OsVP1، دو عامل رونویسی دخیل در پاسخ به تنش‌های غیر زیستی در برنج

نویسندگان

1 بخش تحقیقات فیزیولوژی مولکولی، پژوهشکده بیوتکنولوژی کشاورزی ایران، کرج، ایران دانشکده زیست‌شناسی، پردیس علوم، دانشگاه تهران، تهران، ایران

2 بخش تحقیقات فیزیولوژی مولکولی، پژوهشکده بیوتکنولوژی کشاورزی ایران، کرج، ایران

3 دانشکده زیست‌شناسی، پردیس علوم، دانشگاه تهران، تهران، ایران

چکیده

برنج که غذای اصلی بیش از نیمی از مردم جهان است، اغلب به عنوان یکی از حساس‌ترین گیاهان زراعی نسبت به تنش‌های شوری، خشکی و سرما به ویژه در مرحله پس از جوانه‌زنی محسوب می‌شود. گیاهان پس از جوانه‌زنی به بررسی وضعیت محیط می‌پردازند تا از رشد در شرایط نامناسب پرهیز کرده، شانس بقای دانه‌رُست‌ها را افزایش دهند. در آرابیدوپسیس این کار با میانجی‌گری آبسزیک اسید صورت گرفته، نیازمند عوامل رونویسی ABI5 و ABI3 است. موضوع این پژوهش، بررسی وجود سازوکاری مشابه برای توقف رشد القا شده با تنش‌های غیر زیستی در دانه‌رُست‌های برنج از طریق مطالعه بیان دو ژن ‌OsABI5 و OsVP1 (ارتولوگ عوامل رونویسی ABI3 و ABI5) در دو رقم برنج به نام‌های FL478 و IR29 (به ترتیب متحمل و حساس به شوری) است. به منظور اعمال تنش‌های شوری،‌ خشکی و سرما، دانه‌رُست‌های دو روزه به ترتیب به محیط MS حاوی غلظت‌های ایزواسمزی NaCl (صفر، 50، 100 و 150 میلی‌مولار)، مانیتول (صفر، 100، 180 و 275 میلی‌مولار) در دمای 25 درجه سانتیگراد و محیط MS در دمای 4 و 15 درجه سانتیگراد برای مدت 2 و 10 روز انتقال یافتند. در هر دو رقم، تنش‌ها باعث کاهش رشد طولی گیاه و افزایش بیان ژن‌های OsABI5 و OsVP1 شدند. بنابراین، بر اساس نتایج به دست آمده این احتمال وجود دارد که دو عامل رونویسی OsABI5 و OsVP1 به طور مستقیم یا غیر مستقیم تنظیم‌کننده بیان و در نتیجه فعالیت سایر ژن‌های دخیل در توقف رشد القا شده توسط تنش‌های غیر زیستی در برنج باشند.

کلیدواژه‌ها


عنوان مقاله [English]

OsABI5 and OsVP1, two transcription factors involved in abiotic stress response in rice

نویسندگان [English]

  • Maryam-Sadat Shobbar 1
  • Zahra-Sadat Shobbar 2
  • Vahid Niknam 3
1 Department of Molecular Physiology, Agricultural Biotechnology Research Institute of Iran, Karaj, Iran Department of Biology, Faculty of Sciences, University of Tehran, Tehran, Iran
2 Department of Molecular Physiology, Agricultural Biotechnology Research Institute of Iran, Karaj, Iran
3 Department of Biology, Faculty of Sciences, University of Tehran, Tehran, Iran
چکیده [English]

Rice (Oryza sativa L.) which is the main food for more than half of the world’s population, is often considered as one of the most drought, salt and cold-sensitive crop plants particularly at early stages of post germination. Plants monitor the environmental status during a post-germination growth arrest and this prevents them to grow under unfavourable conditions which ultimately helps them to survive. In Arabidopsis, this response is mediated by abscisic acid and requires the ABI5 and ABI3 transcription factors. In this research, we investigated whether a similar abiotic stress induced growth arrest mechanism was operating in rice seedlings through the expression analysis of OsVP1 and OsABI5 (rice orthologues of the Arabidopsis transcription factors ABI3 and ABI5) in two rice cultivars, FL478 and IR29, which were salt tolerant and sensitive respectively. For exposing to salt, drought or cold stresses, the two-day seedlings were transferred to MS media complemented with iso-osmotic concentrations of NaCl (0, 50, 100 and 150 mM) or mannitol (0, 100, 180 and 275 mM) at 25°C or MS media at 4 and 15°C for 10 days. In both cultivars, stresses decreased shoot growth and increased the transcript level of OsABI5 and OsVP1 genes. Therefore, based on the achieved results, probably, OsABI5 and OsVP1 transcription factors either directly or indirectly regulated the expression of other genes involved in abiotic stress-induced growth arrest in rice.

کلیدواژه‌ها [English]

  • Rice (Oryza sativa L.)
  • Gene expression
  • Abiotic stresses
  • OsABI5
  • OsVP1

 

تنش‌های غیر زیستی مانند شوری، خشکی و سرما محصول‌دهی گیاهان زراعی را به شدت کاهش می‌دهند (Sreenivasulu et al., 2007). از نظر مولکولی، هم‌پوشانی بسیاری بین مسیرهای پاسخ به خشکی، شوری و سرما و مسیر ترارسانی آبسزیک اسید (ABA) در گیاهان وجود دارد (Zhang et al., 2006). آبسزیک اسید در شرایط محیطی تنشی تولید می‌شود و نقش مهمی در تحمل گیاهان به تنش‌ها بازی می‌کند. گروهی از ژن‌ها که در اثر خشکی، شوری و سرما القا شده و در پاسخ و تحمل به تنش نقش دارند، در مسیر ترارسانی پیام آبسزیک اسید عمل می‌کنند (Zhou et al., 2010).

ABI3/VP1 عاملی رونویسی با ناحیه B3 است که در ترارسانی پیام آبسزیک اسید نقش دارد و بسته به زمینه پروموتری (promoter context) می‌تواند به هر دو صورت فعال‌کننده (activator) و مهارکننده (repressor) عمل کند (McCarty et al., 1991; Hoecker et al., 1995; Nambara et al., 1995). ژن Vp1 (Viviparous-1) در ذرت پاسخ‌های نموی متعددی را در مرحله بلوغ بذر تنظیم می‌کند و آلل غیرعملگر (Null) Vp1 باعث عدم خفتگی بذر یا زنده‌زایی (vivipary) در ذرت می‌شود (McCarty et al., 1989). جهش‌یافته‌های abi3 آرابیدوپسیس در جنبه‌های متعددی از نمو و جوانه‌زنی بذر دچار تغییراتی هستند که ناشی از کاهش حساسیت به آبسیزیک اسید است (Giraudat et al., 1992). این جهش‌یافته‌ها دانه‌هایی تولید می‌کنند که به خشکی مقاوم نیستند (Kermode, 2005). تمامی پروتئین‌های ABI3/VP1 دارای چهار ناحیه حفظ شده شامل یک ناحیه اسیدی فعال‌کننده و سه ناحیه بازی به نام‌های B1، B2 و B3 هستند .(Kermode, 2005) ناحیه B3 انتهای کربوکسیل به طور اختصاصی به توالی عنصر Sph (CATGCA) در پروموتر C1 ذرت متصل می‌شود (Suzuki et al., 1997)، در حالی که ناحیه‌‌های B1 و B2 انتهای آمین (N-terminal) در جای‌گیری هسته‌ای و برهم‌کنش با سایر پروتئین‌ها نقش دارند (Giraudat et al., 1992; Ezcurra et al., 2000).برای مثال، ناحیه ‌B1 برای میان‌کنش فیزیکی با ABI5 ضروری است (Nakamura et al., 2001). Vp1 به عنوان فعال‌کننده رونویسی بسته به عناصر سیس هدف با دو سازوکار مختلف عمل می‌کند: Vp1 می‌تواند از طریق عنصر Sph به طور مستقیم به DNA اتصال یابد و یا از طریق میان‌کنش با یک پروتئین bZIP (مثل ABI5) روی عناصر ABRE عمل کند (Hattori et al., 1995; Suzuki et al., 1997; Nakamura et al., 2001).

خانواده پروتئینی ABI3/VP1، عمل آبسزیک اسید را در پیشبرد انباشتگی ذخایر دانه‌ای و تولید حفاظت‌کننده‌های تنشی میانجی‌گری می‌کند (Kermode, 2005). در یک مطالعه ریزآرایه
(Oligo microarray) از گیاهان آرابیدوپسیس تراریخته با 35S::VP1در زمینه جهش‌یافته abi3، 353 ژن تنظیم‌شونده با VP1/ABA شناسایی شد. 73 درصد از ژن‌ها تحت تأثیر هر دو عامل VP1) و (ABA واقع می‌شدند که دال بر ارتباط نزدیک میان علامت‌رسانی آبسزیک اسید و عملکرد VP1 است (Suzuki et al., 2003). ABI5 که تنظیم‌کننده مثبت پیام‌رسانی ABA است، توسط VP1 فعال می‌شود و اثر القایی ABA بر ABI1 و ABI2 که تنظیم‌کننده‌های منفی پیام‌رسانی ABA هستند، به شدت توسط VP1 مهار می‌شود. این نتایج حاکی از این است که VP1 از طریق تنظیم پیش‌خوردی (feed-forward regulation) ژن‌های مربوط به ABI1/ABI5، پیام‌رسانی ABA را به شدت تنظیم می‌کند. بررسی آماری توالی‌های بالادست ژن‌های تنظیم‌شونده با VP1/ABA، از غنای عناصر پاسخ‌دهنده به آبسیزیک اسید (abscisic responsive elements) خبر داد. بنابراین، بسیاری از این ژن‌ها می‌توانند هدف مستقیم bZIPهای وابسته به ABI5 باشند. عنصر Sph نیز با فراوانی بالاتری در پروموتر ژن‌های تنظیم‌شونده با VP1 و ABA یافت می‌شود، در حالی که در پروموتر ژن‌هایی که تنها با ABA تنظیم می‌شوند، چنین نیست (Suzuki et al., 2003). تاکنون، اورتولوگ‌های ABI3/VP1 در گونه‌های گیاهی بسیاری از جمله برنج جداسازی شده است. اورتولوگ ژن VP1 ذرت در برنج، به نام ژن‌ OsVP1، بر روی بازوی بلند کروموزوم 1 برنج واقع شده است (Hattori et al., 1994؛ Kermode, 2005؛ Shobbar et al., 2008).

ABI5 عاملی رونویسی با زیپ لوسین بازی (bZIP) است (Finkelstein and Lynch, 2000; Lopez-Molina and Chua, 2000). این ژن طی جوانه‌زنی بذر، استقرار و رشد اولیه دانه‌رُست‌ها به شدت به ABA برون‌زاد (exogenous) پاسخ می‌دهد، دورانی که گیاهان پیش از آغاز رشد رویشی به بررسی وضعیت اسمزی محیط می‌پردازند. ABI5 برای نگه داشتن جنین‌ها در وضعیتی خاموش لازم است تا از گیاهان در مقابل خشکی محافظت کند. همان طور که از یک عامل کلیدی در فرآیند‌های راه‌اندازی شده با ABA انتظار می‌رود، تجمع، فسفریلاسیون، پایداری و فعالیت پروتئین ABI5، طی جوانه‌زنی و رشد اولیه دانه‌رُست‌ها به شدت توسط ABA تنظیم می‌شود (Lopez-Molina et al., 2001). ABI5 و پروتئین‌های bZIP خویشاوند دارای 6 ناحیه حفظ شده هستند. ناحیه بازی متصل‌شونده به DNA، عناصر سیس ABRE را شناسایی می‌کند (Hobo et al., 1999; Carles et al., 2002; Nakashima et al., 2006). ناحیه بازی متصل‌شونده به DNA و زیپ لوسین مسؤول هومو و هترو دیمریزاسیون هستند (Vinson et al., 2006). ناحیه‌های C1 تا C4 در میان‌کنش‌های مختلف شرکت نموده، دارای جایگاه‌های فسفریلاسیون شناخته شده یا بالقوه هستند (Furihata et al., 2006). برای مثال، دو ناحیه حفظ شده باردار در انتهای آمین پروتئین برای میان‌کنش با ABI3 لازم است (Nakamura et al., 2001). OsABI5 اورتولوگ ژن ABI5 در برنج است. دو رونوشت مختلف OsABI5-1 و OsABI5-2 برای این ژن شناسایی شده است که پروتئین‌هایی با 378 و 388 اسیدآمینه را رمز می‌کنند. هر دو رونوشت نواحی حفظ شده یکسانی دارند و 10 اسید آمینه اضافه OsABI5-2 پس از ناحیه زیپ لوسین در انتهای کربوکسیل قرار دارد (Zou et al., 2007). بیان دو ژن OsABI5 و OsVP1 به طور درخور توجهی طی توقف رشد القا شده توسط تنش خشکی و آبسیزیک اسید در دمگل و توسط تیمار ABA در دانه‌رُست‌های جوان افزایش می‌یابد (Shobbar et al., 2008).

در این پژوهش، اثر تنش‌های شوری، خشکی و سرما بر بیان دو ژن OsVP1 و OsABI5 در دانه‌رُست‌های برنج مطالعه شد تا نقش احتمالی آنها در توقف رشد القا شده با تنش در مرحله پس از جوانه‌زنی روشن گردد. امید است که نتایج این پژوهش برای تولید رقم‌های متحمل به تنش‌های غیر زیستی و به کمینه رساندن افت محصولات زراعی در آینده مفید واقع شود.


مواد و روش‌ها

کشت گیاه و اعمال تنش‌ها

بذرهای دو رقم برنج به نام‌های IR29 و FL478 (به ترتیب متحمل و حساس به شوری) از مؤسسه بین‌المللی تحقیقات برنج (IRRI) تهیه شد. به منظور اعمال تنش‌های شوری،‌ خشکی و سرما، دانه‌رُست‌های دو روزه برای مدت 2 و 10 روز به ترتیب به محیط MS حاوی غلظت‌های ایزواسمزی NaCl (صفر، 50، 100 و 150 میلی‌مولار) و مانیتول (صفر، 100، 180 و 275 میلی‌مولار) در دمای 25 درجه سانتیگراد و محیط MS در دمای 4 و 15 درجه سانتیگراد انتقال یافتند. شاخه و ریشه ‌دانه‌رُست‌های ١٢ روزه (پس از ١٠ روز اعمال تنش) اندازه‌گیری و بلافاصله در ازت مایع فریز و تا زمان انجام آزمایشات در فریزر 7٠- درجه سانتیگراد نگهداری شد.

استخراج و تیمار RNA-RNA

استخراج و تیمار RNA-RNA تام با استفاده از محلول ترایزول (Invitrogen, Carlsbad, CA) طبق دستورالعمل سازنده استخراج شد. کمّیت و کیفیّت RNA بر اساس جذب نوری با دستگاه اسپکتروفوتومتر و بررسی باندهای مربوطه در ژل الکتروفورز تعیین و تأیید شد. RNAهای استخراج شده با آنزیم
RNase-free DNase I، (Promega Corporation, Madison, WI) تیمار شد. عدم وجود DNA توسط PCR تأیید و همسان‌سازی غلظت RNAهای مختلف بر اساس 18S rRNA و 28S rRNA انجام شد.

سنتز cDNA و واکنش زنجیره‌ای پلیمراز در زمان واقعی (real-time PCR)

سنتز cDNA با استفاده از کیت سنتز cDNA Invitrogen انجام و آغازگرهای اختصاصی مناسب طراحی شدند (جدول 1). الگوی بیان ژن مورد نظر توسط PCR در زمان واقعی با استفاده از کیت بیو-رد (BIO-RAD, iQ Sybr Green Supermix) و دستگاه ترموسایکلر همین شرکت (iCycler iQ real-time PCR, Bio-Rad) بررسی شد. ژن‌ خانه‌دار ریبونوکلئیک اسید ریبوزومی 18s (18s rRNA) (Jain et al., 2006) به عنوان شاهد درون‌زاد (endogenous control) در نظر گرفته شد. میزان بیان ژن با روش efficiency adjusted ΔΔCt (Pfaffl, 2001) محاسبه شد. در این روش، همه داده‌ها با ژن 18s rRNAبه عنوان شاهد درون‌زاد نرمال (هنجار) شده و سپس میزان تغییرات بیان ژن در تنش‌های مختلف نسبت به شاهد سنجیده شد.

تحلیل آماری

تمامی آزمایش‌های انجام شده بر اساس طرح کاملاً تصادفی و با کمینه سه تکرار انجام شد. تجزیه واریانس و مقایسه میانگین داده‌ها توسط آزمون چند دامنه‌ای دانکن در سطح احتمال 5 درصد با استفاده از نرم‌‌افزار MSTATC نسخه 42/1 انجام شد.

 

نتایج

اثر تنش‌های شوری، خشکی و سرما بر رشد طولی شاخه

هر سه تنش شوری، خشکی و سرما باعث کاهش رشد طولی شاخه (shoot) هر دو رقم مورد مطالعه شدند. البته اثر مهاری تنش سرما بر رشد شاخه به ترتیب بیش از خشکی و شوری بود (شکل 1). همچنین، تفاوت‌هایی بین میزان کاهش رشد دانه‌رُست‌های دو رقم مورد بررسی مشاهده شد؛ به صورتی‌که طول شاخه دانه‌رُست‌های رقم IR29 تحت همه تیمارهای تنشی به طور معنی‌داری کاهش یافت، در حالی که رشد طولی شاخه دانه‌رُست‌های رقم FL478 تحت غلظت‌های 50 و 100 میلی‌مولار نمک یا 100 میلی‌مولار مانیتول تغییر معنی‌داری نشان نداد. بنابراین، بر اساس نتایج به‌دست آمده دانه‌رُست‌های رقم متحمل به شوری FL478 بهتر از رقم IR29 رشد طولی خود را تحت تنش شوری و خشکی حفظ کردند.

 

بررسی الگوی بیان ژن‌های  OsVP1و OsABI5 تحت تنش‌های غیر زیستی

OsVP1- طبق نتایج حاصل از بررسی دانه‌رُست‌های دو روزه، بیان ژن OsVP1 در هر دو رقم IR29 و FL478 تحت شدیدترین تیمار شوری و خشکی اعمال شده افزایش درخور توجه و معنی‌داری یافت (شکل 2 الف). هر دو تیمار سرما باعث افزایش چشمگیری در بیان این ژن در رقم FL478 شد، در حالی که تنها تیمار 15 درجه سانتیگراد افزایش معنی‌دار در میزان بیان این ژن در رقم IR29 را به دنبال داشت. شایان ذکر است که افزایش بیان ژن OsVP1 تحت هر سه تنش شوری، خشکی و سرما در FL478 نسبت به IR29 شدیدتر بود و در هر دو رقم، اثر تنش‌های سرما و شوری بیش از خشکی بود.

بر اساس نتایج به دست آمده از بررسی دانه‌رُست‌های 10 روزه، سه تنش شوری، خشکی و سرما باعث افزایش بیان OsVP1 در هر دو رقم مورد مطالعه شد. البته تیمار شوری تنها در بالاترین سطح اعمال شده چنین اثری داشت و در غلظت‌های پایین‌تر تغییر معنی‌داری در میزان رونوشت این ژن ایجاد نکرد (شکل 2 ب). طبق مقایسه دانه‌رُست‌های 2 و 10 روزه، اثر تیمار 150 میلی‌مولار نمک در دانه‌رُست‌های 10 روزه به مراتب نسبت به دانه‌رُست‌های دو روزه کاهش یافت. شایان ذکر است که افزایش بیان OsVP1 تحت بیشتر تیمارهای تنشی اعمال شده در دو روزگی در FL478 بیش از IR29 بود، در حالی‌که در 10 روزگی در IR29 بیشتر بود.

OsABI5- تغییر میزان رونوشت OsABI5-2 در رقم FL478 تحت تنش‌های مورد بررسی روند مشابهی با OsVP1 داشت؛ به طوری‌که تحت سرما و شدیدترین تنش شوری و خشکی اعمال شده افزایش یافت و اثر سرما و شوری بیش از خشکی بود (شکل 3 ب). در رقم IR29 نیز میزان رونوشت OsABI5-2 تحت تیمارهای خشکی و 15 درجه سانتیگراد به طور چشمگیری افزایش یافت، در حالی که تحت بالاترین تیمار شوری به میزان جزیی افزایش نشان داد. مقایسه دو رقم مورد مطالعه نشان داد که اگرچه اثر تنش‌های شوری و سرما بر میزان رونوشت OsABI5-2 در رقم FL478 بیش از IR29 بود، با وجود این، اثر خشکی بر رونوشت این ژن در IR29 بیشتر بود. میزان بیان رونوشت OsABI5-1 در هر دو رقم تحت تمامی تیمارهای مورد مطالعه از جمله شاهد، بسیار کمتر از OsABI5-2 بود. میزان رونوشت OsABI5-1 در FL478 تحت هیچ یک از تیمارهای شوری و خشکی تغییر معنی‌داری پیدا نکرد، در حالی‌که تحت هر دو تیمار سرما افزایش چشمگیری یافت. میزان این رونوشت در IR29 تحت تیمارهای 100 و 275 میلی‌مولار خشکی و 15 درجه‌ سانتیگراد افزایش پیدا کرد و همانند رونوشت OsABI5-2 تحت تیمار 4 درجه‌ سانتیگراد افزایش درخور توجهی نیافت (شکل 3 الف).


 

 

 

جدول 1- فهرست آغازگرهای اختصاصی

نام ژن
شماره دستیابی

پرایمر رفت (foreward)

پرایمر برگشت (reverse)

OsABI5-1
gi|124055244

5' AAAGAGGCAGAGCTGGTTGAG 3'

5' ACCAGAAGCAGGATGAGTGTG 3'

OsABI5-2
gi|124055246

5' CTGACAAAGAAGCAAATGCTGG 3'

5' ACCAGAAGCAGGATGAGTGTG 3'

OsVP1
gi|391884

5' CCCAAAGAAGCAGAGGTTCAC 3'

5' TACCGCATGTTCCACACCTG 3'

 

 

   

شکل 1- الف) نمونه‌ای از دانه‌رُست‌های 12 روزه برنج که به مدت 10 روز تحت تنش‌های شوری، خشکی و سرما قرار گرفته بودند.
ب) رشد طولی دانه‌رُست‌های برنج تحت تنش‌های شوری، خشکی و سرما. مقادیر میانگین 8 تکرار ± SE است. حروف یکسان بیانگر عدم اختلاف معنی‌دار در سطح 5 درصد است. N: میلی‌مولار NaCl؛ M: میلی‌مولار مانیتول؛ C: سانتیگراد.

 

 

   

شکل 2- اثر شدت‌های مختلف تنش‌های شوری، خشکی و سرما بر بیان ژن‌ OsVP1 در شاخه دانه‌رُست‌های برنج (رقم‌های IR29 و FL478)
2 روزه (الف) و 10 روزه (ب) با استفاده از روش PCR در زمان واقعی. محور عمودی نسبت بیان ژن در تنش‌های مختلف به شاهد را نشان می‌دهد. حروف یکسان بیانگر عدم اختلاف معنی‌دار در سطح 5 درصد است. N: میلی‌مولار NaCl؛ M: میلی‌مولار مانیتول؛ C: سانتیگراد.

 

   

ب

 

شکل 3- اثر شدت‌های مختلف تنش‌های شوری، خشکی و سرما بر بیان دو رونوشت ژن ‌OsABI5 (الف- OsABI5-1 و ب- OsABI5-2) در شاخه دانه‌رُست‌های برنج (رقم‌های IR29 و FL478) دو روزه با استفاده از روش PCR در زمان واقعی. محور عمودی نسبت بیان ژن در تنش‌های مختلف به شاهد را نشان می‌دهد. حروف یکسان بیانگر عدم اختلاف معنی‌دار در سطح 5 درصد است (N: میلی‌مولار NaCl،
M: میلی‌مولار مانیتول و C: سانتیگراد).

 

 

میزان رونوشت OsABI5-2 در دانه‌رُست‌های 10 روزه FL478 تحت تیمارهای سرما و 275 میلی‌مولار مانیتول افزایش یافت و در سایر تیمارها تغییر درخور توجهی مشاهده نشد (شکل 4). در رقم IR29 اثر تیمارهای تنشی بر رونوشت OsABI5-2 در دانه‌رُست‌های 10 روزه مشابه با دانه‌رُست‌های دو روزه بود و با تیمارهای 180 و 275 میلی‌مولار مانیتول و 15 درجه سانتیگراد افزایش معنی‌دار یافت، در حالی که در تیمارهای شوری و 4 درجه سانتیگراد تفاوت معنی‌داری با شاهد نداشت. همچنین، اثر تنش خشکی بر رونوشت OsABI5-2 در IR29 در مقایسه با اثر سایر تنش‌ها در این رقم و در مقایسه با اثر این تنش بر FL478 بیشتر بود. مقایسه دانه‌رُست‌های 2 و 10 روزه نشان می‌دهد که با افزایش طول مدت تنش، میزان افزایش بیان این رونوشت تحت تیمارهای سرما و 150 میلی‌مولار نمک در رقم FL478 کمتر شده، نسبت به تنش کوتاه مدت، مشابهت بیشتری بین پاسخ‌دهی دو رقم مشاهده می‌شود. میزان رونوشت OsABI5-1 در دانه‌رُست‌های 10 روزه در هر دو ژنوتیپ و تمامی تیمارها قابل تشخیص نبود.

 

شکل 4- اثر شدت‌های مختلف تنش‌های شوری، خشکی و سرما بر بیان OsABI5-2 در شاخه دانه‌رُست‌های برنج (رقم‌های IR29 و FL478) 10 روزه با استفاده از روش PCR در زمان واقعی. محور عمودی نسبت بیان ژن در تنش‌های مختلف به شاهد را نشان می‌دهد. حروف یکسان بیانگر عدم اختلاف معنی‌دار در سطح 5 درصد است (N: میلی‌مولار NaCl، M: میلی‌مولار مانیتول و C: سانتیگراد).

 

بحث

همانطور که پیش از این یاد شد، گیاهان پس از جوانه‌زنی به بررسی وضعیت اسمزی محیط می‌پردازند تا از رشد در شرایط نامناسب جلوگیری کرده، شانس بقای دانه‌رُست‌ها را افزایش دهند. در آرابیدوپسیس این کار با میانجی‌گری ABA صورت گرفته، نیازمند عوامل رونویسی ABI5 و ABI3 است. تنش‌های خشکی و شوری باعث تجمع ABI5 در دانه‌رُست‌های جوان و جنین می‌شود. طی جوانه‌زنی و رشد دانه‌رُست‌های جوان، تجمع رونوشت و پروتئین، فسفریلاسیون، پایداری و فعالیت ABI5 توسط ABA تنظیم می‌شود. شاید به همین دلیل است که گیاهان تیمار شده با ABA نسبت به تنش کم آبی مقاوم‌ترند. ABI5 برای توقف رشد ضروری است تا گیاهان را در مقابل خشکی محافظت نماید (Lopez-Molina et al., 2001, 2002). پیشنهاد شده است که OsVP1 و OsABI5 ارتولوگ ABI3 و ABI5 در برنج باشند. بر اساس نتایج به دست آمده در این پژوهش، هر سه تنش شوری، خشکی و سرما باعث کاهش رشد طولی شاخه و القای بیان ژن OsVP1 و OsABI5 در رقم‌های مورد مطالعه شدند. نتایج پژوهش حاضر با گزارش‌های Shobbar و همکاران (2008) مطابقت داشت، این پژوهشگران نشان دادند که بیان ژن OsVP1 و OsABI5 تحت تیمار آبسزیک اسید در دانه‌رُست‌های جوان و دمگل برنج القا می‌شود و افزایش بیان این ژن توسط آبسزیک اسید با توقف رشد القا شده با تنش در برنج متناسب است. این نتایج بر نقش مهم آبسزیک اسید در ترارسانی علامت تنش‌های شوری، خشکی و سرما که یکی از نتایج آن توقف رشد است، تأکید می‌کند و به هم‌پوشانی‌های مسیرهای علامت‌رسانی این تنش‌های شایع محیطی با یکدیگر اشاره می‌نماید. افزایش بیان این دو ژن توسط آبسزیک اسید و متناسب با توقف رشد القا شده با تنش در برنج مؤید حفظ شدن عملکرد آنها در آرابیدوپسیس و برنج است. بنابراین، به نظر می‌رسد که این پدیده فرآیندی حفظ شده و کلیدی در میان گیاهان مختلف است.

پردازش جایگزین (alternative splicing) مکانیسمی است که به تولید چند mRNA بالغ (رونوشت) از یک mRNA نابالغ (pre-mRNA) منجر می‌شود، در حالی که لزوماً همه رونوشت‌ها به تولید پروتئین منجر نمی‌شوند. رونوشت‌های ناقص وغیر فعال که مشابه mRNA بالغ فعالیت می‌کنند، می‌توانند به عنوان یک سازوکار تنظیمی عمل کنند و به تولید سطح کمتری از رونوشت صحیح منجر شوند و یا از طریق رقابت با رونوشت کامل در اتصال به ریبوزوم باعث کاهش تولید مقدار پروتئین‌های فعال شوند (Mazzucotelli et al., 2008). همچنین، امکان دارد رونوشت‌های مختلف، پروتئین‌های مجزایی را کد کنند و از این طریق باعث افزایش ظرفیت کدکنندگی ژن‌ها و افزایش تنوع در سطح پروتئین در موجودات عالی شوند. پردازش جایگزین از جنبه‌های مختلف بر متابولیسم RNA تأثیر می‌گذارد، مانند تجزیه RNA از طریق RNAهای بی‌معنی (nonesense)، تأثیر بر اتصال به ریبوزوم و تغییر کارآیی ترجمه. همچنین، آثار پردازش جایگزین روی پروتئین‌ها شامل تولید ایزوفرم‌هایی از پروتئین با کاهش یا افزایش کارآیی، تغییر محل فعالیت و پایداری پروتئین در سلول، تغییر فعالیت آنزیم و تغییرات پس از ترجمه بر روی پروتئین است (Reddy, 2007). پردازش جایگزین به ترتیب در 22 و 2/21 درصد از کل ژن‌های آرابیدوپسیس و برنج اتفاق می‌افتد (Wang and brendel, 2006). هومولوگ40 درصد از ژن‌هایی که در آرابیدوپسیس دچار پردازش جایگزین می‌شوند، در برنج نیز پردازش جایگزین روی آنها اتفاق می‌افتد. این وضعیت محافظت شده در پردازش جایگزین بین گیاهان تک‌لپه و دولپه می‌تواند مبین اهمیت این مکانیسم باشد (Reddy, 2007). اخیراً دانشمندان تأیید کردند مکانیسم‌های پس از رونویسی مانند پردازش جایگزین، تکامل RNA و خاموشی در سطح RNA در تنش‌های غیر زیستی به عنوان پاسخی به شرایط تنش محسوب شده، روی محتوای رونوشت‌ها تأثیر می‌گذارند. احتمال وقوع پردازش جایگزین در گیاهان بر RNA پیکِ (mRNA) ژن‌های کدکننده‌ عوامل رونویسی، گیرنده‌ها و پروتئین‌های دخیل در ترارسانی پیام‌های تنشی بیشتر است (Mazzucotelli et al., 2008). برای ژن OsABI5 نیز دو رونوشت متفاوت گزارش شده است (Zou et al., 2007). OsABI5-2، 10 اسید آمینه اضافه دارد که پس از ناحیه زیپ لوسین در انتهای کربوکسیل قرار دارد و ترجمه یک اگزون اضافه است. با وجود این که هر دو رونوشت، نواحی عملکردی حفظ شده کاملاً یکسانی دارند، تنها OsABI5-2 می‌تواند به G-box متصل شود. همچنین، قدرت برهم‌کنش OsABI5-2 و OsVP1 بیش از OsABI5-1 و OsVP1 است (Zou et al., 2007). بر اساس نتایج به دست آمده در این پژوهش، افزایش میزان رونوشت OsABI5-2 در دانه‌رُست‌های 2 و 10 روزه تحت تنش‌های بررسی شده روند مشابهی با OsVP1 داشت؛ به طوری‌ که تحت تنش سرما و شدیدترین تنش شوری و خشکی اعمال شده افزایش یافت. در حالی‌که رونوشت OsABI5-1 فقط در دانه‌رُست‌های دو روزه قابل تشخیص بود و الگوی القای آن تنها توسط تنش سرما در هر دو ژنوتیپ مورد مطالعه با OsVP1 شباهت داشت. بدین ترتیب، این احتمال وجود دارد که OsABI5-2 رونوشت اصلی بوده، OsABI5-1 نقش تنظیمی یا تکمیلی ایفا کند.

 

سپاسگزاری

از مؤسسه تحقیقات بین‌المللی برنج و پژوهشکده بیوتکنولوژی کشاورزی ایران به علت فراهم آوردن امکانات مالی و اجرایی این پروژه تشکر و قدردانی می‌شود.

 

 

 
 

Carles, C., Bies-Etheve, N., Aspart, L., Leon-Kloosterziel, K. M., Koornneef, M., Echeverria, M. and Delseny, M. (2002) Regulation of Arabidopsis thaliana Em genes: role of ABI5. Plant Journal 30: 373-383.

Ezcurra, I., Wycliffe, P., Nehlin, L., Ellerstrom, M. and Rask, L. (2000) Transactivation of the Brassica napus napin promoter by ABI3 requires interaction of the conserved B2 and B3 domains of ABI3 with different cis-elements: B2 mediates activation through an ABRE, whereas B3 interacts with an RY/G-box. Plant Journal 24: 57-66.

Finkelstein, R. R. and Lynch, T. J. (2000) The Arabidopsis abscisic acid response gene ABI5 encodes a basic leucine zipper transcription factor. Plant Cell 12: 599-609.

Furihata, T., Maruyama, K., Fujita, Y., Umezawa, T., Yoshida, R., Shinozaki, K. and Yamaguchi-Shinozaki, K. (2006) Abscisic acid-dependent multisite phosphorylation regulates the activity of a transcription activator AREB1. Proceedings of the National Academy of Sciences of the USA 103: 1988-1993.

Giraudat, J., Hauge, B. M., Valon, C., Smalle, J., Parcy, F. and Goodman, H. M. (1992) Isolation of the Arabidopsis ABI3 gene by positional cloning. Plant Cell 4: 1251-1261.

Hattori, T., Terada, T. and Hamasuna, S. (1994) Sequence and functional analyses of the rice gene homologous to the maize Vp1. Plant Molecular Biology 24: 805-810.

Hattori, T., Terada, T. and Hamasuna, S. (1995) Regulation of the Osem gene by abscisic acid and the transcriptional activator VP1: analysis of cis-acting promoter elements required for regulation by abscisic acid and VP1. Plant Journal 7: 913-925.

Hobo, T., Kowyama, Y. and Hattori, T. (1999) A bZIP factor, TRAB1, interacts with VP1 and mediates abscisic acid-induced transcription. Proceedings of the National Academy of Sciences of the USA 96: 15348-15353.

Hoecker, U., Vasil, I. K. and McCarty, D. R. (1995) lntegrated control of seed maturation and germination programs by activator and repressor functions of Viviparousl of maize. Developmental Genetics 9: 2459-2469.

Jain, M., Nijhawan, A., Tyagi, A. K. and Khurana, J. P. (2006) Validation of housekeeping genes as internal control for studying gene expression in rice by quantitative real-time PCR. Biochemical and Biophysical Research Communications 345(2): 646-51.

Kermode, A. R. (2005) Role of abscisic acid in seed dormancy. Journal of Plant Growth Regulation 24: 319-344.

Lopez-Molina, L. and Chua, N. H. (2000) A null mutation in a bZIP factor confers ABA-insensitivity in Arabidopsis thaliana. Plant Cell Physiology 41: 541-547.

Lopez-Molina, L., Mongrand, S. and Chua, N. H. (2001) A postgermination developmental arrest checkpoint is mediated by abscisic acid and requires the ABI5 transcription factor in Arabidopsis. Proceedings of the National Academy of Sciences of the USA 98: 4782-4787.

Lopez-Molina, L., Mongrand, S., McLachlin, D. T., Chait, B. T. and Chua, N. H. (2002) ABI5 acts downstream of ABI3 to execute an ABA-dependent growth arrest during germination. Plant Journal 32: 317-328.

Mazzucotelli, E., Mastrangelo, A. M., Crosatti, C., Guerra, D., Stanca, A. M., Cattivelli, L. (2008) Abiotic stress response in plants: when post-transcriptional and post-translational regulations control transcription. Plant Science 174: 420-443.

McCarty, D. R., Carson, C. B., Lazar, M. and Simonds, S. C. (1989) Transposable element induced mutations of the viviparous- 7 gene of maize. Developmental Genetics 10: 473-481.

McCarty, D. R., Hattori, T., Carson, C. B., Vasil, V., Lazar, M. and Vasil, I. K. (1991) The Viviparous-1 developmental gene of maize encodes a novel transcriptional activator. Cell 66: 895-905.

Nakamura, S., Lynch, T. J. and Finkelstein, R. R. (2001) Physical interactions between ABA response loci of Arabidopsis. Plant Journal 26: 627-35.

Nakashima, K., Fujita, Y., Katsura, K., Maruyama, K., Narusaka, Y., Seki, M., Shinozaki, K. and Yamaguchi-Shinozaki, K. (2006) Transcriptional regulation of ABI3- and ABA-responsive genes including RD29B and RD29A in seeds, germinating embryos andseedlings of Arabidopsis. Plant Molecular Biology 60: 51-68.

Nambara, E., Keith, K., McCourt, P. and Naito, S. (1995) A regulatory role for the ABI3 gene in the establishment of embryo maturation in Arabidopsis thaliana. Development 121: 629-636.

Pfaffl, M. W. (2001) A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Research 29: 2002-2007.

Reddy, A. S. (2007) Alternative splicing of pre-messenger RNAs in plants in the genomic era. Annual Review in Plant Biology 58: 267-294.

Shobbar, Z. S., Oane, R., Gamuyao, R., De Palma, J., Malboobi, M. A., Karimzadeh, G., Jalali Javaran, M. and Bennett, J. (2008) Abscisic acid stimulates gene expression in cortical fiber and silica cells of rice shoots. New phytologist 178(1): 68-79.

Sreenivasulu, N., Sopory, S. K. and Kavi Kishor, P. B. (2007) Deciphering the regulatory mechanisms of abiotic stress tolerance in plants by genomic approaches. Gene 388: 1-13.

Suzuki, M., Kao, C. Y. and McCarty, D. R. (1997) The conserved B3 domain of VIVIPAROUS1 has a cooperative DNA binding activity. Plant Cell 9: 799-807.

Suzuki, M., Ketterling, M. G., Li, Q. B. and McCarty, D. R. (2003) Viviparous1 alters global gene expression patterns through regulation of abscisic acid signaling. Plant Physiology 132(3): 1664-1677.

Vinson, C., Acharya, A. and Taparowsky, E. J. (2006) Deciphering B-ZIP transcription factor interactions in vitro and in vivo. Biochimica et Biophysica Acta 1759: 4-12.

Wang, B. B. and Brendel, V. (2006) Genomewide comparative analysis of alternative splicing in plants. Proceedings of the National Academy of Sciences of the USA 103: 7175-7180.

Zhang, J., Jia, W., Yang, J. and Ismail, A. M. (2006) Role of ABA in integrating plant responses to drought and salt stresses. Journal of Field Crops Research 97: 111-119.

Zhou, M. L., Ma, J. T., Pang, J. F., Zhang, Z. L., Tang Y. X. and Wu, Y. M. (2010) Regulation of plant stress response by dehydration responsive element binding (DREB) transcription factors. Journal of Biotechnology 9: 9255-9279.

Zou, M., Guan, Y., Ren, H., Zhang, F. and Chen, F. (2007) Characterization of alternative splicing products of bZIP transcription factors OsABI5. Biochemical and Biophysical Research Communications 360(2): 307-313.