بررسی تأثیر متقابل ترهالوز و آسکوربیک اسید بر برخی شاخص‌های رشد و بیان ژن‌های فتوسنتزی در گیاهچه‌های Arabidopsis thaliana

نویسندگان

گروه زیست‌شناسی، دانشکده علوم، دانشگاه گلستان، گرگان، ایران

چکیده

ترهالوز دی‌ساکاریدی است که از دو مولکول گلوکز با پیوند آلفا 1-1 تشکیل شده است. تیمار ترهالوز روی گیاهچه‌های آرابیدوپسیس از رشد ریشه، ظهور برگ‌های اولیه و تخصیص کربن از برگ به ریشه ممانعت می‌کند. در پژوهش حاضر سعی شده است تأثیر متقابل آسکوربیک اسید و ترهالوز روی برخی شاخص‌های رشد و بیان ژن‌های فتوسنتزی در گیاهچه‌های آرابیدوپسیس تالیانا بررسی شود. به این منظور، بذر آرابیدوپسیس در محیط کشت پایه MS، محیط کشت پایه حاوی 1/0 میلی‌مولار آسکوربیک اسید، محیط کشت پایه حاوی 100 میلی مولار ترهالوز و محیط کشت پایه حاوی 1/0 میلی‌مولار آسکوربیک اسید و 100 میلی مولار ترهالوز به مدت 15 روز کشت شدند. نتایج نشان داد که قند ترهالوز سبب کاهش طول ریشه، وزن خشک و تر شده است. در حالی که میزان قند محلول، نشاسته، آسکوربیک اسید، دهیدرو اسکوربیک اسید، آسکوربیک اسید کل و نیز فعالیت آنزیم ترهالاز افزایش یافت. اما افزودن همزمان ترهالوز و آسکوربیک اسید به محیط کشت سبب افزایش طول ریشه، وزن خشک و تر شده، سبب کاهش میزان قند محلول، نشاسته، آسکوربیک اسید، دهیدرو آسکوربیک اسید، آسکوربیک اسید کل و نیز فعالیت آنزیم ترهالاز شد. بررسی الگوی بیان ژن نیز نشان داد که ترهالوز سبب سرکوب بیان ژن‌های سوکروز فسفات سنتاز، اینورتاز و سوکروز ترانسپورتر شده است. تیمار ترهالوز به تنهایی بیان ژن‌های فتوسنتزی را سرکوب می‌کند اما تیمار همزمان ترهالوز و آسکوربیک اسید تا حدودی سرکوب این ژن‌ها را کاهش می‌دهد. در مجموع، نتایج حاضر نشان می‌دهد که اثر بازدارندگی ترهالوز بر رشد گیاهچه‌های آرابیدوپسیس می‌تواند به دلیل ممانعت آن بر انتقال قند سوکروز از بافت منبع (برگ) به بافت مخزن (ریشه) باشد.

کلیدواژه‌ها


عنوان مقاله [English]

An investigation on interaction between trehalose and ascorbic acid on some growth parameters and photosynthetic gene expression in Arabidopsis thaliana seedlings

نویسندگان [English]

  • Nadia Rezaeean
  • Mahnaz Aghdasi
  • Hamid Sadeghipour
Department of Biology, Faculty of Sciences, Golestan University, Gorgan, Iran
چکیده [English]

Trehalose is an α-α linked glucose disaccharide. Trehalose supplied to the growth medium of Arabidopsis seedlings inhibits root growth, primary leaf development and carbon allocation from shoot to root. In the current study, interaction between trehalose and ascorbic acid on some growth parameters and photosynthetic gene expression was investigated in Arabidopsis seedlings. For this purpose, Arabidopsis seeds were grown on MS medium, MS medium supplemented with 0.1 mM ascorbic acid, MS medium supplemented with 100 mM trehalose and MS medium supplemented with 0.1 mM ascorbic acid combined with 100 mM trehalose for 15 days. The results showed that trehalose decreased root length, and dry and fresh weight as well. Meanwhile, the amount of soluble sugar, starch, ascorbic acid, dehydroascorbate, total ascorbic acid and trehalase activity were increased by trehalose treatment. On the other hand, the combination of trehalose and ascorbic acid treatment increased root length, dry and fresh weight and decreased soluble sugar, starch, ascorbic acid, dehydroascorbate, total ascorbic acid and trehalase activity. Gene expression profiling showed that trehalose suppressed SUS, INV and SUC expression. But ascorbic acid partially lowered gene expression suppression mediated by trehalose. In summary, the current results showed that the inhibitory effect of 100 mM trehalose on Arabidopsis seedlings growth can be because of its inhibitory effect on sucrose transport from source tissue (leaf) to sink tissue (root).

کلیدواژه‌ها [English]

  • Arabidopsis thaliana
  • Trehalose
  • Ascorbic acid
  • starch
  • Gene expression

 

ترهالوز دی‌ساکاریدی غیر احیایی است که از دو مولکول گلوکز با پیوند آلفا 1-1 ساخته شده است. این قند در گستره وسیعی از موجودات زنده وجود دارد. پیش‌ماده این قند در گیاهان، ترهالوز-6-فسفات (T6P) است که از اتصال گلوکز-6-فسفات و
UDP- گلوکز و با دخالت آنزیم ترهالوز-6-فسفات سینتاز (TPS) ساخته می‌شود. سپس، T6P توسط آنزیم ترهالوز-6-فسفات فسفاتاز (TPP) دفسفریله شده، ترهالوز تولید می‌شود. ترهالاز نیز آنزیمی است که ترهالوز را به دو مولکول گلوکز تجزیه می‌کند (Elbin et al., 2003).

تاکنون آثار مهم و متنوعی از ترهالوز در زندگی گیاهان گزارش شده است. برای نمونه می‌توان به نقش آن در فرایند فتوسنتز، گل‌دهی، مقاومت به تنش‌های محیطی و مصرف کربن در گیاهان اشاره کرد Schluepmanne et al., 2003)؛ Pellny et al., 2004؛ Schluepmanne et al., 2004؛ Van Dijken et al., 2004). این در حالی است که افزودن ترهالوز به محیط کشت گیاه آرابیدوپسیس از رشد ریشه و ظهور برگ‌های اولیه ممانعت می‌کند wingler et al., 2000)؛ Schluepmanne et al., 2004؛ Aghdasi et al., 2010). یکی از آثار مورد توجه تیمار ترهالوز بر گیاهچه‌های آرابیدوپسیس تجمع نشاسته در لپه‌ها است در حالی که در منطقه کلاهک ریشه هیچ نشاسته‌ای مشاهده نمی‌شود Wingler et al., 2000)؛ Aghdasi et al., 2010؛ (Delatte et al., 2011. پیش از این نیز نشان داده شده بود که تجمع نشاسته در کوتیلدون‌ها به علت فعال شدن AGPase و نیز ممانعت از تخریب نشاسته در این بخش از گیاه است، در حالی که چنین پدیده‌ای در ریشه مشاهده نمی‌شود Kolbe et al., 2005)؛ Ramon et al., 2007). نتایج سایر پژوهش‌ها نشان داده است که افزودن قندهای قابل متابولیزه شدن (نظیر گلوکز، فروکتوز و یا سوکروز) به محیط کشت حاوی 100 میلی‌مولار ترهالوز، آثار بازدارنده ترهالوز را بر گیاهچه‌های آرابیدوپسیس متوقف می‌کند. این نتایج نشان می‌دهد که آثار بازدارنده ترهالوز مربوط به نقش آن در مصرف کربن است (Schluepmanne et al., 2004؛ (Wingler et al., 2006. از سوی دیگر، پژوهشگران نشان داده‌اند که آثار بازدارنده تیمار ترهالوز بر گیاهچه‌های آرابیدوپسیس به تجمع پیش‌ماده آن یعنی T6P مربوط است (Schluepmanne et al., 2004). همچنین گزارش شده است که T6P مولکول پیام‌رسان مهمی است که آثار مهمی در رشد، نمو و متابولیسم گیاهان دارد Eastmond et al., 2002)؛ Satoh-Nagasawa et al., 2006؛ (Paul et al., 2008. پیش از این گزارش شده بود که افزودن آسکوربیک اسید به محیط کشت حاوی ترهالوز سبب افزایش طول ریشه‌های گیاه آرابیدوپسیس می‌شود. در حالی که تیمار ترهالوز (با غلظت 100 میلی‌مولار) سبب کاهش میزان کلروفیل، طول ریشه و پروتئین کل و نیز افزایش میزان آنتوسیانین، پراکسیدهیدروژن، پروتئین محلول و افزایش فعالیت آنزیم‌های آنتی‌اکسیدان در گیاهچه‌های آرابیدوپسیس می‌شود، افزودن آسکوربیک اسید به محیط کشت حاوی ترهالوز تا حدودی این آثار را جبران می‌نماید (Vahdati et al., 2010).

با توجه به نقش مهم ترهالوز در تخصیص و مصرف کربن، در پژوهش حاضر سعی شده است تا تأثیر ترهالوز بر برخی شاخص‌های فتوسنتز و نیز بیان برخی از ژن‌های درگیر در تخصیص کربن بین بافت منبع (برگ) و بافت مخزن (ریشه) بررسی شود. از جمله ژن‌هایی که در تخصیص کربن بین بافت منبع و مخزن دخالت دارند می‌توان به ژن‌های: اینورتاز (INV)، سوکروز ترانسپورتر (SUC) و سوکروز فسفات سینتاز (SPS) اشاره کرد. سوکروز در گیاهان قند مهمی است که توسط بافت فلوئم منتقل می‌شود و متابولیسم آن برای مصرف هگزوزها از اهمیت زیادی برخوردار است (Koch, 1996). همچنین، با توجه به این که کاربرد همزمان آسکوربیک اسید به همراه غلظت 100 میلی‌مولار ترهالوز برخی آثار بازدارنده ترهالوز را تخفیف می‌دهد، گیاهچه‌های آرابیدوپسیس بر روی محیط کشت پایه MS، محیط کشت پایه حاوی 1/0 میلی‌مولار آسکوربیک اسید، محیط کشت پایه حاوی 100 میلی‌مولار ترهالوز و نیز محیط کشت پایه حاوی 100میلی‌مولار ترهالوز و 1/0 میلی‌مولار آسکوربیک اسید کشت شده تا بر هم‌کنش این دو بر فرآیندهای رشد و بیان ‍ژن‌های فتوسنتزی بررسی شود.

 

مواد و روش‌ها

بذرهای آرابیدوپسیس تالیانا (Arabidopsis thaliana) رقم کلمبیا- صفر (Col-0) ابتدا در اتانول70 درصد به مدت 10 دقیقه ضد عفونی سطحی شده، به مدت 10 دقیقه در آب ژاول 20 درصد قرار گرفتند. پس از اتمام ضد عفونی، بذرها 5 بار با آب مقطر استریل شستشو شدند و در چهار نوع محیط کشت پایه MS، محیط کشت حاوی 100 میلی‌مولار ترهالوز، محیط کشت حاوی 1/0 میلی‌مولارآسکوربیک اسید و محیط کشت حاوی 100میلی‌مولار ترهالوز و 1/0 میلی‌مولار آسکوربیک اسید کشت شدند(Murashige and skoog, 1962). به منظور شکستن خواب بذر، پیش از انتقال به اتاقک کشت به مدت 2-4 روز در تاریکی و در 4 درجه سانتیگراد نگهداری شدند. پس از 15 روز شاخص‌های رشد گیاهچه‌ها از جمله: رشد طولی ریشه، خروج برگ‌های اولیه و وزن تر و خشک اندازه‌گیری و مقایسه شد.

.اندازه‌گیری وزن تر و خشک: تعداد 50 عدد از گیاهچه‌های 15 روزه آرابیدوپسیس پس از برداشت توزین شده، میانگین وزن تر آنها محاسبه شد. این نمونه‌ها به مدت 72 ساعت در درجه حرارت 70 درجه سانتیگراد در آون قرار گرفته، پس از توزین میانگین وزن خشک نیز محاسبه گردید.

.اندازه‌گیری طول ریشه: ابتدا از ظروف حاوی گیاهچه‌های 15 روزه آرابیدوپسیس عکس‌برداری شد، سپس با نرم‌افزار ImageJ طول ریشه 50 عدد از گیاهچه‌های هر تیمار اندازه‌گیری شد و با نرم‌افزار Excel میانگین هر تیمار اندازه‌گیری شد و نمودارها رسم شد.

.اندازه‌گیری آسکوربیک اسید، .دهیدروآسکوربیک اسید و آسکوربیک اسید کل: عصاره‌گیری با روش Jana و Choudhuri (1981) انجام شد. اندازه‌گیری آسکوربیک اسید، دهیدروآسکوربیک اسید و آسکوربیک اسید کل بر اساس روش De Pinto و همکاران (1999) انجام شد. برای به دست آوردن میزان دهیدرو آسکوربیک اسید، میزان آسکوربیک اسید هر یک از تکرارها از آسکوربیک اسید کل کسر گردید و بدین ترتیب میزان دهیدروآسکوربیک اسید محاسبه شد.

.اندازه‌گیری قندهای محلول و نشاسته: اندازه‌گیری قندهای محلول و نشاسته با روش Kochert (1978) انجام شد. در این روش، به 20 میلی‌گرم ماده خشک گیاهی 2 میلی‌لیتر اتانول 70 درصد اضافه کرده و به مدت یک هفته در یخچال قرار داده شد. پس از 15 دقیقه سانتریفیوژ در g 10000، از فاز رویی محلول برای اندازه‌گیری قندهای محلول و از رسوب باقی مانده برای اندازه‌گیری قندهای نامحلول استفاده شد.

.اندازه‌گیری فعالیت آنزیم ترهالاز: سنجش فعالیت آنزیم ترهالاز با تلفیقی دو روش Prado و همکاران (1998) و Muller و همکاران (2001) و بر مبنای میزان گلوکز آزاد شده در واحد زمان با استفاده از روش اسپکتروفتومتری انجام شد.

.استخراج RNA و RT-PCR: استخراج RNA از برگ و ریشه گیاهچه‌های آرابیدوپسیس طبق روش Sambrook و Russell (2001) صورت گرفت. به این منظور، میزان 1/0 گرم از گیاهچه‌های آرابیدوپسیس در نیتروژن مایع ساییده شده و به آن مقدار 750 میکرولیتر بافر استخراج اضافه شد. پس از افزودن 750 میکرولیتر مخلوط فنل-کلروفرم-ایزو آمیل الکل (به نسبت 25: 24: 1) به مدت 2 دقیقه ورتکس شد و به مدت 5 دقیقه روی یخ انکوبه گردید. پس از سانتریفیوژ، فاز آبی به لوله جدید منتقل شده، مجدداً مخلوط فنل-کلروفرم-ایزو آمیل الکل به آن اضافه گردید. پس از سانتریفیوژ، فاز مایع بالایی برداشته، پس از اضافه کردن یک حجم ایزو پروپانول به آن به مدت 5 دقیقه در دمای اتاق انکوبه گردید. به دنبال سانتریفیوژ به مدت 10 دقیقه و حذف محلول بالایی، رسوب به دست آمده در 5/0 میلی‌لیتر آب مقطر استریل حل شده، 5/0 میلی‌لیتر لیتیوم کلرید 4 مولار به آن اضافه گردید. در مرحله بعد، نمونه به دست آمده به مدت 3 ساعت بر روی یخ انکوبه شد و پس از 20 دقیقه سانتریفیوژ رسوب به دست آمده در آب مقطر استریل حل گردید. با افزودن استات سدیم 3 مولار و اتانول 96 درصد محلول به دست آمده به مدت یک شب در فریزر با دمای 20- درجه سانتیگراد انکوبه گردید. پس از سانتریفیوژ و شستشو با اتانول 70 درصد، رسوب به دست آمده در آب مقطر استریل حل شد و در دمای 80- درجه سانتیگراد نگهداری گردید. غلظت RNA استخراج شده توسط اسپکتروفتومتر در طول موج 260 نانومترتعیین شد. به منظور حذف DNA ژنومیک، 10 نانوگرم از RNA استخراج شده با 2 واحد از DNase (DNA-free, Ambion, Austin, USA) تیمار شد.

.طراحی پرایمر: پرایمرهای ویژه ژن‌های مورد بررسی و نیز پرایمرهای اکتین (Actin-F and R) با نرم‌افزار Primer 3 طراحی (جدول 1) و از شرکت امینسان تهیه شد.

.واکنش RT-PCR: واکنش RT-PCR با استفاده از کیت PreMlx AccuPowerRocketScript RT-PCR (BioNEER, Japan) در حجم کلی 20 میکرولیتر با محتوای 2 میکروگرم RNA، 1 واحد آنزیم Prime Script، 5/12 میکرولیتر بافر آنزیم Prime Script، 5/0 میکرولیتر از هر یک از پرایمرهای R و F در دستگاه PCR با برنامه حرارتی: واسرشته شدن در دمای 94 درجه سانتیگراد به مدت 2 دقیقه برای چرخه اول و برای چرخه دوم به بعد 30 ثانیه، اتصال آغازگرها در دمای 60 درجه سانتیگراد به مدت 30 ثانیه و بسط در دمای 72 درجه سانتیگراد به مدت 1 دقیقه انجام شد. محصول PCR با استفاده از الکتروفورز روی ژل آگاروز 2 درصد جداسازی شد. در پایان، ژل‌های به دست آمده با اتیدیوم بروماید رنگ‌آمیزی شدند.

 


جدول 1- پرایمرهای مورد استفاده برای هر یک از ژن‌ها در واکنش RT-PCR

پرایمر برگشت

پرایمر رفت

ژن هدف

TTCTTCGTTCTCCACGTTGGA

GCTGCACCACGAACCAGTAGA

TRE1

CTGAGAATCCTCCCATTCCA

GAAGAAACGCAGCAGAAACC

SPS1

GACAACCAAACAAAGTGGACC

CTCTGCCCAAATCAGTTGATCACG

INV

GGCTTTTCCATCGGCTGTTGGCTCTG

ACAGTTCGGTTGGGCTTTACAGTTATCTC

SUC

GCCAAGTGATTGTGGACTC

GACCCAAAGACGGAGACTCTT

Actin

 


تحلیل آماری: تمامی آزمایشات با 5 تکرار در قالب طرح آزمایشی کاملاً تصادفی انجام شد. در تمام اندازه‌گیری‌ها رسم نمودار با نرم‌افزار Excel و آنالیز واریانس داده‌ها با نرم‌افزار SAS و آزمون دانکن محاسبه گردید.

 

نتایج

.بررسی شاخص‌‌های رشد: بررسی گیاهچه‌های رشد یافته در محیط کشت پایه MS پس از 15 روز نشان داد که این گیاهچه‌ها دارای ریشه‌های طویل بوده، برگ‌های اولیه و ثانویه در آن ظاهر شده‌اند. افزودن آسکوربیک اسید به محیط کشت پایه تغییری در مورفولوژی گیاهچه‌ها ایجاد نکرده، برگ‌های اولیه و ثانویه در این گیاهچه‌ها نیز پس از 15 روز رشد ظاهر شده و سبز رنگ بود. تنها تغییر مشاهده شده در این گیاهچه‌ها موج‌دار شدن ریشه‌ها است. از سوی دیگر، طول ریشه‌ها در این گیاهچه‌ها به طور معنی‌داری بیشتر از گیاهچه‌های رشد یافته در محیط کشت پایه فاقد آسکوربیک اسید است (شکل 1)، اما مورفولوژی گیاهچه‌های رشد یافته در محیط کشت حاوی غلظت 100 میلی‌مولار ترهالوز تفاوت آشکاری را نسبت به دو محیط قبلی نشان داد. در این گیاهچه‌ها، برگ‌های اولیه و ثانویه ظاهر نشده، برگ‌های لپه‌ای حاشیه قرمز رنگ دارند. همچنین، گیاهچه‌ها ریشه‌های کوتاه (3 میلی‌متر) داشتند که به طور معنی‌داری کوتاه‌تر از طول ریشه گیاهچه‌های رشد یافته در دو محیط کشت قبلی بود. افزودن آسکوربیک اسید به محیط کشت حاوی ترهالوز سبب افزایش طول ریشه در این گیاهچه‌ها و نیز ظهور برگ‌های اولیه شد (شکل 1 و جدول 2).

 

 

 
 

B

 
 
 

 

A

 

شکل 1- (A مورفولوژی گیاهچه‌های آرابیدوپسیس پس از 15 روز رشد بر روی محیط کشت پایه (MS)، آسکوربیک اسید (AA)، ترهالوز (Tre) و ترهالوز+آسکوربیک اسید (Tre+AA)؛ (B طول ریشه. مقادیر، میانگین 5 تکرار ± SE است. حروف یکسان بیانگر عدم اختلاف معنی‌دار با استفاده از آزمون دانکن (P<0.05) است.

جدول 2- نتایج آنالیز واریانس شاخص‌های مورد بررسی در گیاهچه‌های آرابیدوپسیس پس از 15 روز رشد بر روی محیط کشت پایه (MS)، آسکوربیک اسید (AA)، ترهالوز (Tre) و ترهالوز+آسکوربیک اسید (Tre+AA). * در سطح کمتر از 5 درصد معنی‌دار است. ** در سطح کمتر از 1 درصد معنی‌دار است.

منبع تغییر

درجه آزادی

قند محلول

نشاسته

وزن خشک

میزان طول ریشه

آسکوربیک اسید

آسکوربیک اسید کل

دهیدروآسکوربیک اسید

فعالیت ترهالاز

میزان وزن تر

تیمار

4

**7/347

**72/116

*0023/0

**0217/1

**209/1

**77/123

**1721/0

**97/21245

**544/0

خطا

16

14/6

26/11

000345/0

0062/0

0094/0

0118/0

01023 /0

01147/0

0331/0

 

 

نتایج به دست آمده نشان داد که میانگین وزن تر گیاهچه‌های رشد یافته در محیط کشت پایه MS حدود 8/1 میلی‌گرم است. افزودن آسکوربیک اسید به محیط کشت سبب کاهش معنی‌دار وزن تر گیاهچه‌ها شد. همچنین، وزن تر گیاهچه‌های رشد یافته در محیط کشت حاوی ترهالوز کاهش معنی‌داری را نسبت به گیاهچه‌های رشد یافته در دو محیط قبلی نشان دادند. همچنین، افزودن آسکوربیک اسید به محیط کشت حاوی ترهالوز سبب افزایش معنی‌دار در وزن تر گیاهچه‌ها شد. گیاهچه‌های رشد یافته در محیط کشت پایه یا محیط کشت پایه حاوی آسکوربیک اسید تفاوت معنی‌داری در وزن خشک نشان نداد. اما افزودن قند ترهالوز به محیط کشت سبب کاهش معنی‌دار در وزن خشک گیاهچه شد (شکل 2).

.اندازه‌گیری قند محلول و نشاسته: اندازه‌گیری‌ها نتایج نشان داد که میزان قند محلول در گیاهچه‌های 15 روزه آرابیدوپسیس رشد یافته بر روی محیط کشت پایه حدود 5 میلی‌گرم بر گرم وزن خشک است. افزودن آسکوربیک اسید به محیط کشت پایه موجب افزایش معنی‌دار در میزان قند محلول گیاهچه‌ها نسبت به گروه شاهد شد. افزودن ترهالوز به محیط کشت نیز موجب افزایش معنی‌دار در میزان قندهای محلول در مقایسه با گیاهچه‌های رشد یافته در محیط کشت پایه یا محیط کشت پایه حاوی آسکوربیک اسید شد. افزودن آسکوربیک اسید نیز به محیط کشت حاوی ترهالوز به افزایش بیشتر قندهای محلول منجر شد (شکل 3-A).

نتایج حاصل از اندازه‌گیری میزان نشاسته در گیاهچه‌های 15 روزه آرابیدوپسیس نشان داد که میزان نشاسته در گیاهچه‌های رشد یافته در محیط کشت پایه برابر با 87/57 میلی‌گرم بر گرم وزن تر گیاه است (شکل 3-B). افزودن آسکوربیک اسید به محیط کشت پایه تفاوت معنی‌داری در میزان نشاسته گیاهچه‌ها ایجاد نکرد. اما تیمار ترهالوز سبب افزایش حدود 6 برابری نشاسته درگیاهچه‌ها شد. افزودن آسکوربیک اسید به محیط کشت حاوی ترهالوز باعث کاهش معنی‌دار در میزان نشاسته در مقایسه با گیاهچه‌های رشد یافته در محیط کشت حاوی ترهالوز شد.

.سنجش محتوای آسکوربیک اسید، آسکوربیک .اسید کل و دهیدروآسکوربیک اسید: نتایج نشان داد که میزان آسکوربیک اسید، آسکوربیک اسید کل و دهیدروآسکوربیک اسید در گیاهچه‌های 15 روزه آرابیدوپسیس رشد یافته در محیط کشت پایه MS، به ترتیب: 5/1، 72/2 و22/1 میکروگرم بر گرم وزن تر است (شکل 4). افزودن آسکوربیک اسید به محیط کشت پایه، به کاهش معنی‌دار میزان آسکوربیک اسید و آسکوربیک اسید کل در گیاهچه‌ها منجر شد. همچنین، تیمار ترهالوز نیز سبب افزایش معنی‌دار در میزان آسکوربیک اسید، آسکوربیک اسید کل و دهیدروآسکوربیک اسید در گیاهچه‌ها شد. افزودن آسکوربیک اسید به محیط کشت حاوی ترهالوز سبب کاهش میزان آسکوربیک اسید، آسکوربیک اسید کل و دهیدروآسکوربیک اسید در مقایسه با گیاهچه‌های رشد یافته روی محیط کشت حاوی ترهالوز شد (شکل 4).

.بررسی فعالیت آنزیم ترهالاز: نتایج حاصل از بررسی فعالیت آنزیم ترهالاز در گیاهچه‌های 15 روزه آرابیدوپسیس نشان داد که فعالیت این آنزیم در محیط کشت پایه، حدود 75 میکروگرم بر دقیقه بر میلی‌گرم وزن تر است. افزودن آسکوربیک اسید به محیط کشت پایه تفاوت معنی‌داری را در فعالیت آنزیم ترهالاز در گیاهچه‌های مورد بررسی ایجاد نکرد. اما تیمار ترهالوز سبب افزایش معنی‌دار فعالیت ترهالاز در گیاهچه‌ها شد. افزودن آسکوربیک اسید به محیط کشت حاوی ترهالوز به کاهش فعالیت این آنزیم در مقایسه با گیاهچه‌های رشد یافته در محیط کشت ترهالوز منجر شد (شکل 5).

 

 

 

شکل 2- میانگین وزن تر و خشک گیاهچه‌های آرابیدوپسیس پس از 15 روز رشد روی محیط کشت پایه (MS)، محیط کشت پایه حاوی آسکوربیک اسید (AA)، ترهالوز (Tre) و ترهالوز+آسکوربیک اسید (Tre+AA). مقادیر، میانگین 5 تکرار ± SE است. حروف یکسان بیانگر عدم اختلاف معنی‌دار با استفاده از آزمون دانکن (P˂0.05) است.

 

   

شکل 3- (A میزان قند محلول و (B نشاسته در گیاهچه‌های آرابیدوپسیس پس از 15 روز رشد بر روی محیط کشت پایه (MS)، آسکوربیک اسید (AA)، ترهالوز (Tre) و ترهالوز+آسکوربیک اسید (Tre+AA). مقادیر، میانگین 5 تکرار ± SE است. حروف یکسان بیانگر عدم اختلاف معنی‌دار با استفاده از آزمون دانکن (P<0.05) است.

   

شکل 4- (A میزان آسکوربیک اسید، (Bآسکوربیک اسید کل و
(C دهیدرو آسکوربیک اسید، در گیاهچه‌های آرابیدوپسیس پس از 15 روز رشد بر روی محیط کشت پایه (MS)، آسکوربیک اسید (AA)، ترهالوز (Tre) و ترهالوز+آسکوربیک اسید (Tre+AA). مقادیر، میانگین 5 تکرار ± SE است. حروف یکسان بیانگر عدم اختلاف معنی‌دار با استفاده از آزمون دانکن (P<0.05) است.

 

 

 

 

 

شکل 5- میزان فعالیت آنزیم ترهالاز در گیاهچه‌های آرابیدوپسیس پس از 15 روز رشد بر روی محیط کشت پایه (MS)، آسکوربیک اسید (AA)، ترهالوز (Tre) و ترهالوز+آسکوربیک اسید (Tre+AA). مقادیر، میانگین 5 تکرار ± SE است. حروف یکسان بیانگر عدم اختلاف معنی‌دار با استفاده از آزمون دانکن (P<0.05) است.

 


تحلیل بیان ژن: نتایج حاصل از بیان ژن ترهالاز در گیاهچه‌های 15 روزه آرابیدوپسیس نشان داد که این ژن در گیاهچه‌های رشد یافته روی محیط کشت پایه MS و نیز محیط کشت پایه به همراه آسکوربیک اسید دارای سطح بیان پایینی است. افزودن ترهالوز به محیط کشت پایه سبب افزایش بیان این ژن در گیاهچه‌ها شد. افزودن آسکوربیک اسید به محیط‌کشت حاوی ترهالوز سبب کاهش بیان ژن ترهالاز شد (شکل 6).

بررسی ‌الگوی بیان ژن‌های سوکروز فسفات سینتاز (SPS)،اینورتاز (INV) و سوکروزترانسپورتر (SUC) در گیاهچه‌های رشد یافته در محیط کشت پایه و محیط کشت پایه حاوی آسکوربیک اسید تفاوتی نشان نداد. اما افزودن قند ترهالوز به محیط کشت سبب سرکوب بیان این ژن‌ها می‌شود. در حالی که افزودن آسکوربیک اسید به محیط کشت حاوی ترهالوز تا حدودی اثر بازدارنده ترهالوز را بر بیان ژن‌های SPS، INV و SUCکاهش داد.

 

شکل 6- الگوی بیان ژن‌های ترهالاز (TRE1)، سوکروز فسفات سینتاز (SPS)، اینورتاز (INV) و سوکروز ترانسپورتر (SUC) در گیاهچه‌های آرابیدوپسیس پس از 15 روز رشد بر روی محیط کشت پایه (MS)، آسکوربیک اسید (AA)، ترهالوز (Tre) و ترهالوز همراه با آسکوربیک اسید (Tre+AA). در این آزمایش از اکتین به عنوان شاهد داخلی استفاده شده است.

 

بحث

نتایج سایر پژوهش‌ها نشان داده است که افزودن قند ترهالوز با غلظت 100 میلی‌مولار به محیط کشت گیاه آرابیدوپسیس سبب کاهش رشد گیاهچه‌ها، ارغوانی شدن حاشیه برگ‌ها، کوتاه شدن طول ریشه‌ها و عدم ظهور برگ‌های اولیه Wingler et al., 2000)؛ Kolbe et al., 2005؛ (Aghdasi et al., 2010 می‌شود. همچنین، نتایج بررسی‌های اولیه نشان داد که کاربرد 1/0 میلی‌مولار آسکوربیک در محیط کشت تا حدودی آثار بازدارنده ترهالوز را بر رشد گیاهچه‌های آرابیدوپسیس کاهش می‌دهد (Vahdati et al., 2010).

در پژوهش حاضر سعی شده است تا نحوه تأثیر ترهالوز و آسکوربیک اسید بر برخی شاخص‌های رشد و بیان تعدادی از ژن‌های فتوسنتزی در گیاه آرابیدوپسیس بررسی شود. نتایج نشان داد که ترهالوز سبب کاهش وزن تر و خشک گیاهچه‌های رشد یافته بر روی محیط کشت ترهالوز شده است. کاهش رشد گیاهان آرابیدوپسیس در اثر افزودن ترهالوز احتمالاً به علت تجمع ترهالوز-6-فسفات ((T6P در این گیاهچه‌ها است Schluepmanne et al., 2004)؛ Aghdasi et al., 2010). از آنجا که افزودن قندهای قابل متابولیزه شدن به محیط کشت حاوی ترهالوز آثار ممانعت رشدی حاصل از آن را کاهش می‌دهد (Schluepmanne et al., 2004) می‌توان ادعا کرد که علت کاهش رشد گیاهچه آرابیدوپسیس در تیمار ترهالوز به علت کمبود کربن در مناطق رشد بوده، ترهالوز بر توانایی بافت منبع در متابولیسم کربن تخصیص یافته اثری ندارد.

تیمار گیاهچه‌های آرابیدوپسیس با آسکوربیک اسید سبب کاهش میزان آسکوربیک اسید و آسکوربیک اسید کل در گیاهچه‌ها شد. این احتمال وجود دارد که تیمار با آسکوربیک اسید خارجی سبب افزایشبازگشتآسکوربیک اسید درون‌زاد شود. بیشترین میزان آسکوربیک اسید و آسکوربیک اسید کل در تیمار ترهالوز دیده شد. از سوی دیگر، نشان داده شده است که پایداری آسکوربیک اسید در حضور ترهالوز به ‌میزان شایان توجهی افزایش می‌یابد (Bellocco et al., 2007) که این امر می‌تواند علت افزایش آسکوربیک اسید در این گیاهچه‌ها باشد. همچنین، میزان آسکوربیک اسید، آسکوربیک اسید کل و دهیدروآسکوربیک اسید درگیاهچه‌های رشد یافته در محیط کشت حاوی آسکوربیک اسید و ترهالوز بالاتر از گیاهچه‌های رشد یافته در محیط کشت حاوی آسکوربیک اسید بوده است که این افزایش را نیز می‌توان به‌علت پایداری آسکوربیک اسید در حضور ترهالوز دانست.

ترهالاز آنزیمی است که قند ترهالوز را به دو مولکول گلوکز تجزیه می‌کند. بررسی‌ فعالیت آنزیم ترهالاز و بررسی‌های مولکولی بیان ژن نشان داد که فعالیت و بیان ژن مربوط به این آنزیم با تیمار ترهالوز افزایش می‌یابد. اما افزایش بیان و فعالیت این آنزیم آنقدر بالا نیست که بتواند اثر انباشتگی ترهالوز بر گیاهچه‌های آرابیدوپسیس را خنثی کند.

سوکروز قند انتقالی در آوندهای آبکش است. سوکروز فسفات سینتاز (SPS)، آنزیم کلیدی بیوسنتز سوکروز است که سوکروز را از پیش‌سازهای آن یعنی گلوکز و فروکتوز سنتز می‌کند. بررسی‌های مولکولی بیان این ژن نشان داد که تیمار ترهالوز بیان ژن SPS را سرکوب می‌کند. این امر نشان از آسیب حاصل از رادیکال‌های آزاد ایجاد شده توسط تنش اکسیداتیو به سیستم فتوسنتزی گیاه دارد. در نتیجه، انباشتگی گلوکز در بافت‌های فتوسنتز کننده این گیاهچه‌ها رخ می‌دهد و با توجه به عدم فعالیت آنزیم SPS در گیاهچه‌های تحت تیمار ترهالوز، گلوکزهای آزاد شده صرف سنتز سوکروز نمی‌شوند. گلوکز به‌ دلیل داشتن پیوند آلدئیدی یک قند ناپایدار است و در آوند آبکش به سرعت اکسیده می‌شود. انباشتگی مونوساکاریدها باعث کاهش پتانسیل اسمزی سلول شده، در نتیجه گلوکز پلیمریزه شده و نشاسته سنتز می‌گردد. با توجه به عدم انتقال نشاسته در گیاه، نشاسته‌ سنتز شده در بافت‌های فتوسنتز کننده ذخیره می‌گردند. نتایج حاصل از سنجش میزان نشاسته نیز نشان می‌دهد که نوک ریشه‌ها (بافت مخزن) فاقد نشاسته است در حالی ‌که مقادیر بالایی از نشاسته در برگ‌های گیاهان تیمار شده با ترهالوز وجود دارد (Vahdati et al., 2010). در گیاهانی که در شرایط طبیعی رشد می‌کنند سیستم فتوسنتزی به طور عادی به فعالیت خود ادامه داده، ژن سوکروز فسفات ‌سینتاز نیز دارای بیان طبیعی است. بنابراین، سوکروز به طور معمول سنتز شده و از طریق سوکروز ترانسپورترها (SUSs) به بخش‌های مختلف گیاه از جمله بافت مخزن ارسال می‌شود و در آن جا برای انجام گلیکولیز و چرخه‌ کربس به منظور تأمین انرژی، توسط آنزیم اینورتاز به مونومرهای خود یعنی گلوکز و فروکتوز تجزیه می‌گردد (Zinselmeier et al., 1999). به‌ این ‌ترتیب گیاه چرخه طبیعی خود را حفظ می‌کند اما در گیاهچه‌های تیمار شده با ترهالوز، احتمالاً کاهش بیان ژن SPS سیگنالی برای کاهش بیان ژن سوکروز ترانسپورتر و ژن اینورتاز (INV) است، زیرا با وجود فقدان سنتز سوکروز در بافت‌های فتوسنتز کننده، سنتز طبیعی پروتئین‌های انتقال دهنده و تجزیه کننده سوکروز غیر معقولانه به نظر می‌رسد. نتایج حاصل از بیان ژن SUC و ژن INV نیز بیان ناچیزی از این دو ژن را نشان داد.

یکی از نقش‌های آسکوربیک اسید در گیاهان تأثیر بر تکثیر و طویل شدن سلول‌ها است (Smirnoff, 1996). با توجه به تنش اکسیداتیو ایجاد شده در گیاه تحت تیمار ترهالوز، میزان آسکوربیک اسید در سلول‌های مریستمی کاهش می‌یابد که این امر موجب کاهش رشد ریشه می‌گردد و ریشه به عنوان بافت مخزن قدرت متابولیکی خود را برای کسب کربن از بافت‌های منبع از دست می‌دهد. با توجه به نقش آسکوربیک اسید در تقسیم و طویل شدن سلول (Smirnoff, 2000) می‌توان این‌ طور نتیجه گرفت که سلول‌های ریشه شروع به رشد کرده، تکثیر می‌شوند و برای تأمین انرژی مورد نیاز خود از ذخایر نشاسته‌ای استفاده می‌کنند و علت کاهش نشاسته تحت تیمار آسکوربیک اسید می‌تواند همین امر باشد. در تیمار آسکوربیک اسید، کاهش میزان نشاسته در گیاهچه‌ها مشاهده شد. همچنین، گزارش‌های دیگر نیز نشان داده است که پیش‌تیمار گیاهان کلزا و اسفناج با آسکوربیک اسید سبب افزایش بیان برخی ژن‌های فتوسنتزی نظیر LHCB و RBCSدرتنش اکسیداتیو می‌شود (Navabpour et al., 2011). علاوه بر این، گزارش‌های دیگری نیز نشان داده است که علاوه بر آسکوربیک اسید ترکیبات دیگری نیز قادر به کاهش تنش اکسیداتیو در گیاهان هستند. برای مثال، پیش‌تیمار گیاه گوجه‌فرنگی با نیترو پروساید سدیم سبب کاهش آثار تنش اکسیداتیو و حفظ محتوای رنگیزه فتوسنتزی شده است (Nasibi, 2011).

قندهای محلول گروه دیگری از محافظت‌کننده‌های اسمزی هستند. تجمع کربوهیدرات‌های محلول در پاسخ به تنش‌های محیطی در ارتباط با تنظیم اسمزی و یا حفاظت غشاهای سلولی است (Roitsch, 1999). بنابراین، می‌توان این طور نتیجه‌گیری کرد که افزایش قندهای محلول می‌تواند به علت تنظیم اسمزی و تحریک بیان برخی ژن‌های مقاوم به تنش اکسیداتیو در این گیاهچه‌ها ‌باشد. در تیمار آسکوربیک اسید افزایشی در میزان قندهای محلول در گیاهچه‌ها مشاهده شد. از آنجا ‌که D-گلوکز پیش‌ماده اولیه آسکوربیک اسید است، بنابراین، تجزیه آسکوربیک اسید خارجی جذب شده در گیاه به پیش‌سازهای خود به افزایش قندهای محلول منجر می‌شود. در نهایت، می‌توان نتیجه‌گیری نمود که ترهالوز در غلظت‌های بسیار پایین در گیاهان به عنوان یک مولکول پیام‌رسان بسیار مهم در زمان مواجهه گیاه با تنش‌های گوناگون عمل می‌کند. زمانی که گیاه به‌ طور مصنوعی با غلظت بسیار بالای ترهالوز مواجه می‌شود این قند جذب گیاه شده و تنش اکسیداتیو را القا می‌کند. بنابراین سیستم‌های آنتی‌اکسیدان فعال شده، پیامدهای ناشی از آن مشاهده می‌شود. در نتیجه، رشد ریشه کاهش می‌یابد، برگ‌ها ارغوانی می‌شوتد، سیستم فتوسنتزی دچار نقص می‌شود و به‌تدریج گیاه به سمت خودکشی سلولی پیش می‌رود. افزودن آسکوربیک اسید در محیط کشت حاوی ترهالوز تا حدودی توانسته است آثار این تنش را تعدیل نماید.

 

سپاسگزاری

نگارندگان این مقاله از معاونت پژوهشی دانشگاه گلستان برای حمایت مالی پژوهش حاضر نهایت تشکر و قدردانی را دارند.

 

 

 

Aghdasi, M., Schluepmanne, H. and Smeekens, S. (2010) Characterization of Arabidopsis seedlings growth and development under trehalose feeding. Journal of Cell and Molecular Biology Research 2: 1-19.

Bellocco, E. a., Barreca, a., Lagana, G. a., Leuzzi, U. a., Migliardo, F. b., Torre, R. b., Galli, G. b., Galtiri, A., Minutoli, L. C. and Squadrito, F. C. (2007) Neutroscattering and HPLC study on L-ascorbic acid and its degradation. Chemical Physics Journal 345: 191-195.

De Pinto, M. C., Francis, D. and De Gara, L. (1999) The redox state of the ascorbate-dehydroascorbate pair as a specific sensor of cell division in tobacco by 2 cells. Protoplasma 209: 90-97.

Delatte, T. L., Sedijani, P., Kondou, Y., Matsui, M., de Jong, D., Somsen, O. W., Wiese- linkenberg, A., Primavesi, L. F., Paul, M. and Schluepmann, H. (2011) Growth arrest by trehalose-6-phosphate: an astonishing case of primary metabolite control over growth by way of the SnRK1 signaling pathway. Plant physiology 157: 160-174.

Eastmond, P. J., Van Dijken, A. J., Speiman, M., Kerr, A., Tissier, A. F., Dichinson, H. G., Jones, J. D., Smeekens, S. C. and Graham, I. A. (2002) Trehalose-6-phosphate synthase 1 which catalyses the first step in trehalose synthesis is essential for Arabidopsis embryo maturation. Plant Journal 29: 223-235.

Elbin, A. D., Pan, Y. T., Pastuszak, I. and Carroll, D. (2003) New insights on trehalose: a multification molecule. Glycobiology 13: 17R-27R.

Jana, S. and Choudhuri, M. A. (1981) Glycolate metabolism of three submereged aquatic angiosperms during aging. Aquatic Botany 12: 342-354.

Koch, K. E. (1996) Carbohydrate modulated gene expression in plants. Annual Review of Plant Physiology and Plant Molecular Biology 47: 509-540.

Kochert, G. (1978) Handbook of physiological and biochemical methods. Cambridge University Press, London.

Kolbe, A., Tiessen, A., Schluepmann, H., Paul, M., Ulrich, S. and Giegenberger, P. (2005) Trehalose 6-phosphate regulates starch synthesis via posttranslational redox activation of ADP-glucose pyrophosphorylase. Proceeding of the National Academy of Sciences of USA 102: 11118-11123.

Muller, J., Aeschbacher, R. A., Wingler, A., Boller, T. and Wiemken, A. (2001) Trehalose and trehalase in Arabidopsis. Plant Physiology 125: 1086-1093.

Murashige, T. and Skoog, F. (1962) A revised medium for rapid growth and bioassays with tobacco tissue cultures. Plant Physiology 15:473-479.

Nasibi, F. (2011) Effect of different concentration of sodium nitroprusside (SNP) pretreatment on oxidative damages induced by drought stress in tomato plant. Journal of Plant Biology 9: 63-74 (in Persian).

Navabpour, S., Bagherieh Najar, M. B. and Haddad, R. (2011) Comparison of induced gene response to stressful treatment in Spinach oleraceae and Brassica napus. Agricultural Biotechnology 10: 1-10 (in Persian).

Paul, M., Lucia, F., Primavesi, F., Deveraj, J. and Zhang, Y. (2008) Trehalose metabolism and signaling. Annual Review of Plant Biology 59: 417-441.

Pellny, T. K., Ghannoum, O., Conroy, J. P., Schluepmann, H., Smeekens, S. andralojic, J., Krause, K. P., Goddijn, O. and Paul, M. J. (2004) Genetic modification of photosynthesis with E. coli genes for trehalose synthesis. Plant biotechnology Journal 2(1): 71-82.

Prado, F. E., Gonzalez, J. A., Boero, C. and Sampietro, A. R. (1998) A simple and sensitive method for determining reducing sugars in plant tissues. Application to quantify the sugar content in quinoa seedlings. Phytochemical Analysis 9: 58-63.

Ramon, M. F., Rolland, J. M., Thevelein, P., Van Dijeck, P. and Leyman, B. (2007) AB14 mediates the effects of exogenouse trehalose on Arabidopsis growth and starch breakdown. Plant Molecular Biology Journal 63: 195-206.

Roitsch, T. (1999) Source-sink regulation by suger and stress. Currnt Opinion in Plant Biology 2: 198-206.

Sambrook, J. and Russell, D. W. (2001) Molecular cloning: a laboratory manual. cold spring Harbor laboratory Press, New York.

Satoh-Nagasawa, N., Nagasawa, N., Malcomber, S., Sakai, H. and Jackson, D. (2006) A trehalose metabolic enzyme controls inflorescence architecture in maize. Nature 441: 227-230.

Schluepmanne, H., Pellny, T., Van Dijken, A., Smeekens, S. and Paul, M. (2003) Trehalose 6-phosphate is indispensable for carbohydrate utilization and growth in Arabidopsis thaliana. Proceeding of the National Academy of Sciences of USA 100: 6849-6854.

Schluepmanne, H., Van Dijken, A., Aghdasi, M. Wobbes, B., Pual, M. and Smeekens, S. (2004) Trehalose mediated growth inhabitation of Arabidopsis seedlings is due to trehalose-6-phosphate accumulation. Plant physiology 135: 879-890.

Smirnoff, N. (1996) The function and metabolism of ascorbic acid in plants. Annuals of Botany 78: 661-669.

Smirnoff, N. (2000) Ascorbic biosynthesis and function in photoprotection. Philosophical Transactions of the Royal Society. Biological Sciences 355: 1455-1464.

Vahdati, M., Aghdasi, M. and sadeghipour, H. R. (2010) Interaction of trehalose and ascorbic acid in growing Arabidopsis seedlings. Journal of Plant Production 17: 27-48 (in Persian).

Van Dijken, A. J., Schluepmann, H. and Smeekens, S. C. (2004) Arabidopsis trehalose-6-phosphate synthase 1 is essential for normal vegetative growth and transition to flowering. Plant Physiology 135: 969-977.

Wingler, A., Fritzius, T., Wiemken, A., Boller, T. and Aeschbacher, R. A. (2000) Trehalose induces the ADP-glucose pyrophosphorylase gene, ApL3 and starch synthesis in Arabidopsis. Plant Physiology 124: 105-114.

Wingler, A., Purdy, S., Maclean, J.A. and Pourtau, N. (2006) The role of sugars in integrating environmental signals during the regulation of leaf senescence. Journal of Experimental Botany57: 391-399.

Zinselmeier, C., Jeong, R. B. and Boyer, J. S. (1999) Starch and the control of kernel number in maize at low water polentials. Plant Physiology 121: 259-350.