تأثیر تلقیح دو گونه قارچ میکوریز آربوسکولار بر بیان ژن لیمونن‌سنتاز در ژنوتیپ‌های نعنا سبز (Mentha spicata L.)

نویسندگان

1 گروه زیست‌شناسی، دانشکده علوم، دانشگاه شهرکرد، شهرکرد، ایران

2 شهرکرد، دانشگاه شهرکرد، دانشکده علوم پایه، گروهزیست شناسی

چکیده

نعنا سبز (Mentha spicata L.) گیاهی با اهمیت اقتصادی و خاصیت دارویی زیاد از تیره Lamiaceae است که به علت سنتز مقادیر زیادی مونوترپن (اسانس) به عنوان مدلی برای متابولیسم این ترکیبات مورد توجه پژوهشگران مختلف قرار دارد. لیمونن یک مونوترپن ساده است که بیوسنتز آن توسط لیمونن‌سنتاز که یک آنزیم تنظیمی کلیدی در مسیر بیوسنتزی مونوترپن‌ها در M. spicata است، کاتالیز می‌شود. در مطالعه حاضر، تأثیر کلونیزاسیون ریشه با قارچ‌های etunicatum Funneliformis و F. mosseae بر شاخص‌های رشد، غلظت اسانس و تغییرات بیان ژن لیمونن‌سنتاز (LS) در سه ژنوتیپ (کاشان، بجنورد و میبد) نعنا سبز بررسی شده است. استفاده از ژن GADPH به عنوان استاندارد داخلی برای اندازه‌گیری بیان کمّی ژن لیمونن‌سنتاز در بررسی حاضر توضیح داده می‌شود. نتایج این تحقیق نشان داد که محتوای اسانس در برگ‌های M. spicata ژنوتیپ میبد تلقیح شده با قارچ F. etunicatum بیشتر از ژنوتیپ‌های گرفته شده از جمعیت‌های کاشان و بجنورد است و در مقایسه با شاهد 130 درصد افزیش را نشان داد. بر اساس نتایج پژوهش حاضر، افزایش تجمع رونوشت‌های ژن لیمونن‌سنتاز در برگ‌های M. spicata تحت تأثیر تلقیح با قارچ‌های میکوریز آربوسکولار، هماهنگ با افزایش محتوای اسانس و تحت تأثیر ژنوتیپ گیاه است.

کلیدواژه‌ها


عنوان مقاله [English]

The effect of inoculation with mycorrhizal arbuscular fungion expression of limonene synthase in Mentha spicata L. genotypes

نویسندگان [English]

  • Masoumeh Ahmadi-Khoei 1
  • Leila Shabani 2
1 Department of Biology, Faculty of Sciences, University of Shahrekord, Shahrekord, Iran
2 Department of Biology, Faculty of Sciences, University of Shahrekord, Shahrekord, Iran
چکیده [English]

Spearmint (Mentha spicata L.) is an important economical and medicinal plant from Lamiaceae family, which has gained research attraction as a model for biosynthesis of essential oils due to its high capability for synthesis of monoterpenes. Limonene is a simple monoterpene and its biosynthesis is catalyzed by limonene synthase; a key regulatory enzyme in the biosynthesis pathway of monoterpenes in spearmint plant. This study was concerned with the effect of colonization of roots with Funneliformis mosseae and F. etunicatum fungi on spearmint plant growth indices, leaf essential oils and changes in the expression of limonene synthase (LS) gene. This study also explained the application of GADPH gene as the internal standard for real-time quantitative PCR (RTqPCR) analysis of LS in spearmints. Our results showed that essential oil content of leaf in spearmint genotype Meybod inoculated with F. etunicatum was higher than that of genotypes from populations Kashan and Bojnourd and was 130% higher than the control. According to the results of this study, increase in transcript accumulation of the LS gene in leaves of spearmint plants inoculated with F. etunicatum was concordant with the increased essential oil contents and was dependent on the plant genotype.
 
 
 

کلیدواژه‌ها [English]

  • Study of floristics, life form and chorology of plants in Shimbar protected area (Khuzestan province) Mehri Dinarvand 1, Hamid Ejtehadi 1*, Mohammad Jankju 2 and Bahram Andarzian 3 1 Department of Biology, Faculty of Sciences, Ferdowsi University of
  • 2,4-D (0, 0.5, 1 and 1.5 mg/L) and Kinetin (0, 0.1, 0.5 and 1 mg/L) were used to study its effects on callus formation and growth in Taxus baccata. It was determined that 1.5 mg/L 2,4-D + 0.1 mg/L kinetin was the best combination for callus growth. I
  • a key regulatory enzyme in the biosynthesis pathway of monoterpenes in spearmint plant. This study was concerned with the effect of colonization of roots with Funneliformis mosseae and F. etunicatum fungi on spearmint plant growth indices, leaf essen

 

نعنا سبز (Mentha spicata L.) با نام عمومی spearmint یکی از 25 گونه جنس Mentha و متعلق به تیره Lamiaceae است که اهمیت دارویی آن از زمان‌های بسیار قدیم شناخته شده است و امروزه به منظور استخراج اسانس‌های آن در سطح وسیع کشت می‌شود (Zare Dehabadi and Asrar, 2009). تمامی ویژگی‌های درمانی و دارویی نعنا را می‌توان به ترکیبات ثانویه این گیاه نسبت داد، این ترکیبات از جمله مواد شیمیایی مهم گیاهی محسوب می‌شوند و خط دفاعی اولیه گیاه علیه پاتوژن‌ها را تشکیل می‌دهند (Khan et al., 2005). مهم‌ترین مواد مؤثره نعنا سبز اسانس‌ها هستند که محصولات مهم اقتصادی به شمار می‌آیند. ترکیبات شیمیایی موجود در اسانس نعنا مخلوطی از ترکیبات آروماتیک شامل ترپن‌ها، ترپنوئیدها و ترکیبات آلیفاتیک شامل هیدروکربن‌ها، الکل‌ها، استرها، آلدهیدها، کتون‌ها و فنل‌ها هستند
Li et al., 1999)؛ (Bakkali et al., 2008. ترپن‌های موجود در اسانس M. spicata به دو دسته تقسیم‌بندی می‌شوند: الف) مونوترپن‌های شامل آنتول، پولیگون، کاروون، لیمونن، منتون و S-کاروون و ب) سزکویی ترپن‌ها (Almeida et al., 2012). مسیر بیوسنتز مونوترپن‌ها در M. spicata به خوبی شناسایی شده است. مراحل آنزیمی این مسیر به سه مرحله اصلی تقسیم می‌شود: مرحله نخست شامل افزودن ایزوپنتنیل دی فسفات به دی متیل آلیل دی فسفات به کمک آنزیم ژرانیل دی فسفات سنتاز است که به ایجاد ژرانیل دی فسفات منجر می‌شود؛ در مرحله دوم، ترکیب حد واسط حاصله به واسطه مونوترپن سنتازهای مختلف مانند 4s- لیمونن‌سنتاز (4S-4L) تغییر می‌یابد؛ مرحله آخر بیوسنتز مونوترپن شامل چندین تغییر ثانویه است که با لیمونن آغاز شده و به ایجاد تنوع زیاد در تولید محصولات نهایی منجر می‌گردد. لیمونن‌سنتاز (به عنوان یک مونوترپن سنتاز) مرحله سنتز لیمونن از ژرانیل دی فسفات را کاتالیز می‌کند.

از مهم‌ترین روابط همزیستی موجود در سطح زمین رابطه میکوریزی است (Strack et al., 2003). اصطلاح میکوریزی به نوعی وابستگی بین قارچ و ریشه گیاهان خشکی اطلاق می‌شود که عوامل ایجاد این وابستگی با تشکیل همزیستی دو طرفه از این رابطه سود می‌برند. اهمیت همزیستی برای گیاه شامل بهبود وضعیت تغذیه، حفظ و استفاده بهینه از مواد مغذی و کاهش خسارات زیستی (هجوم پاتوژن و انواع بیماری‌ها) و غیرزیستی (عدم تعادل در تغذیه و کمبود آب) است که به رشد سریع‌تر گیاه منجر می‌شود. این نوع همزیستی به واسطه کاهش هزینه مصرفی و کاهش در آلودگی زیستی با کودهای شیمیایی، از دیدگاه کشاورزی نیز دارای اهمیت است (Silveria et al., 2006). مشخص شده است که قارچ‌های میکوریز آربوسکولار در بسیاری از سیستم‌های کشاورزی بر پایه تولید، نقش مهمی در رشد گیاهان ایفا می‌کنند، اما درباره تأثیر بالقوه آنها بر متابولیت‌های ثانویه در گیاهان دارویی و معطر اطلاعات اندکی وجود دارد. Ahmadi-Khoei و همکاران (2012) افزایش محتوای ترکیبات فنولیک کل در شش ژنوتیپ از M. spicata تلقیح شده با قارچ میکوریز آربوسکولار را نشان دادند. تاکنون مطالعه‌ای درباره تأثیر قارچ‌های میکوریز بر بیان ژن لیمونن‌سنتاز در ژنوتیپ‌های M. spicata انجام نشده است. مطالعات گذشته روی بیان ژن لیمونن‌سنتاز در گیاهان مختلف نشان داده است که بیان این ژن تحت تأثیر شرایط مختلف تغییر کرده است که این تغییر ممکن است با تغییر در محتوای اسانس گیاه همراه باشد. پژوهش حاضر با هدف بررسی تأثیر دو گونه قارچ میکوریز Funneliformis mosseae و F. etunicatum بر شاخص‌های رشد، بیان ژن لیمونن‌سنتاز و مطالعه رابطه بین مقدار اسانس و میزان بیان ژن در شرایط گلخانه‌ای در گیاه M. spicata انجام شده است.


مواد و روش‌ها.

کشت گیاه: ابتدا ریزوم‌های M. spicata از سه منطقه مختلف میبد، کاشان و بجنورد جمع‌آوری و در شرایط گلخانه‌ای، در گلدان‌های حاوی ماسه و خاک رس کشت داده شدند. آبیاری گلدان‌ها یک روز در میان انجام شد. پس از گذشت سه ماه رشد و زمانی که گیاهچه‌ها وارد مرحله زایشی شدند، ساقه‌های آنها با داشتن سه میانگره جهت تلقیح جمع‌آوری و در محیطی کاملاً مرطوب قرار داده شدند. ساقه‌ها پس از مدت یک هفته جوانه زده، سپس ریزوم‌دار شدند. از قارچ‌های همزیست (تهیه شده از شرکت زیست فناوران توران) برای تلقیح ساقه‌های ریزوم‌دار شده M. spicata استفاده شد. برای انجام تلقیح با قارچ میکوریزی mosseae) F. و (F. etunicatum، حدود 25 گرم از مایه تلقیح هر قارچ به طور جداگانه در خاک هر گلدان ریخته شد و تعداد سه عدد از ساقه‌های ریزوم‌دار روی سطح خاک قرار داده شد. گلدان‌ها تا پیش از جوانه‌زنی به صورت یک روز در میان آبیاری شدند و پس از جوانه‌زنی علاوه بر آبیاری یک روز در میان، هفته‌ای یک بار با محلول هوگلند (50 درصد فسفر) آبیاری شدند. پس از گذشت یک دوره رشد سه ماهه و با ورود گیاهچه‌ها به مرحله گل‌دهی نمونه‌گیری از برگ‌های کاملاً رشد یافته گیاه (واقع در میانگره سوم) برای انجام تحقیقات مولکولی صورت گرفت و نمونه‌ها با نیتروژن مایع تثبیت و در فریزر 80- نگهداری شدند. سایر برگ‌های گیاه نیز برای تهیه اسانس در سایه خشک شدند.

تعیین شاخص‌های رشد: برای اندازه‌گیری میزان وزن خشک ریشه و اندام هوایی ابتدا قسمت‌های هوایی گیاهچه‌ها جدا شد و پس از شستشو، آب اضافی آنها توسط کاغذ صافی گرفته شد. برای اندازه‌گیری وزن خشک، ریشه‌ها و ساقه‌ها درون پاکت‌های مقوایی قرار داده شد و پس از گذشت 3 تا 4 روز نمونه‌ها به دور از نور آفتاب خشک شدند و وزن خشک آنها تعیین گردید.

استخراج اسانس: برای تهیه اسانس، برگ‌های خشک شده M. spicata با آسیاب دستی خرد شد. در هر نوبت اسانس‌گیری 30 گرم از گیاه خرد شده، همراه با 200 میلی‌لیتر آب مقطر با استفاده از دستگاه کلونجر در دمای 100 درجه سانتیگراد با روش تقطیر با آب اسانس‌گیری شد. مدت زمان اسانس‌گیری سه ساعت به طور انجامید. اسانس‌های به دست آمده توسط سولفات سدیم آبگیری شد. اندازه‌گیری اسانس با روش حجمی صورت گرفت. پس از خارج نمودن اسانس از مایع درصد اسانس تعیین گردید.

بررسی الگوی بیان ژن: الگوی بیان ژن لیمونن‌سنتاز در برگ‌های کاملاً رشد یافته M. spicata بررسی شد. ژن GAPDH (گلیسر آلدهید 3-فسفات دهیدرروژناز) به عنوان ژن خانه‌دار و ژن LS لیمونن‌سنتاز به عنوان ژن دخیل در پاسخ به تلقیح گیاه با قارچ میکوریز آربوسکولار با مرور منابع انتخاب و توالی آنها با جستجو در بانک‌های اطلاعاتی یافت شد (جدول 1). توالی DNA مربوط به هر ژن از پایگاه NCBI با شماره‌های دستیابی JN587699.1 (برای ژن GAPDH) و L13459.1 (برای ژن LS) به‌ دست آمد. RNA کل با استفاده از بافر QIAzol Lysis Reagent (QIAGEN) از بافت برگ استخراج گردید. برای اطمینان از حذف کامل DNA ژنومی، نمونه‌های RNA با آنزیم DNaseI تیمار شدند. مقادیر مختلف RNA پس از اندازه‌گیری کمّی، همگی به غلظت 75 نانوگرم در میکرولیتر با افزودن مقادیر مناسب آب عاری از Rnase، یکسان‌سازی شدند. پس از همسان‌سازی غلظت RNAهای مختلف، واکنش سنتز cDNA با استفاده از کیت QuantiTect Reverse Transcription انجام شد. الگوی بیان ژن‌ها با استفاده از PCR زمان واقعی (iCycler iQ real-time PCR, Bio-Rad) بررسی شد. میزان بیان ژن با روش 2-ΔΔCt محاسبه گردید (Livak and Schmittgen, 2001). در این روش، میزان بیان ژن لیمونن‌سنتاز بر اساس ژن استاندارد با بیان ثابت نرمال شده، سپس میزان تغییرات بیان ژن در تمام تیمارها نسبت به نمونه‌های شاهد (بدون تلقیح) سنجیده شد.

تحلیل آماری: آزمایش حاضر به صورت فاکتوریل در قالب طرح کاملاً تصادفی در 3 تکرار اجرا گردید. در این حالت سه ژنوتیپ (بجنورد، کاشان و میبد)، سه حالت قارچ (شاهد، قارچ mosseae F. و قارچ F. etunicatum) به عنوان فاکتورها در نظر گرفته شد. تحلیل آماری با نرم‌افزار SAS و MSTATC انجام و مقایسه میانگین‌ها با آزمون LSD (05/0>P) مشخص شد.

 

 

جدول 1- توالی پرایمر ژن‌های ls وgadph

Product size (bp)

Reverse Primer (5'®3')

Forward Primer (5'-3')

Target

171

ACACCTCCGCTATCAGCCAT

TGGAAGAGGTGAGCAGAGGG

LS

114

CTACACAACAGAGCGCGGAA

CTCAGAGAGGAGTCGGTGGG

GADPH

 


نتایج.

پس از اطمینان از آلودگی ریشه‌های هر سه ژنوتیپ M. spicata توسط دو گونه قارچF. mosseae و
F. etunicatum (شکل 1) و پس از تعیین وزن خشک ریشه و اندام هوایی از نمونه‌ها اسانس تهیه شد و سپس درصد اسانس تعیین شد. همچنین، بیان ژن لیمونن‌سنتاز در برگ گیاهچه‌های M. spicata بررسی شد. افزایش وزن تر اندام هوایی در اثر تلقیح میکوریزی در سطح 5 درصد معنی‌دار است. همزیستی موجب افزایش وزن تر اندام هوایی در گیاهچه‌های تیمار شده با هر دو گونه قارچ Funneliformis در مقایسه با گیاهچه‌های شاهد شده است (شکل 2-A). وزن تر ریشه گیاه نیز به طور قابل ملاحظه‌ای تحت تأثیر قارچ میکوریز قرار گرفت (شکل 2-B). در گیاهچه‌های سه ماهه نسبت وزن خشک ریشه به وزن خشک ساقه (R/S) در دو ژنوتیپ بجنورد و میبد در مورد هیچ کدام از تیمارها اختلاف معنی‌داری نشان نداده است (شکل 2-C). به نظر می‌رسد که تلقیح توسط دو گونه قارچ میکوریز در این دو ژنوتیپ به همان نسبت که باعث افزایش وزن خشک اندام هوایی گیاه شد، باعث افزایش وزن خشک اندام زیرزمینی گیاه M. spicata نیز شد. در مورد ژنوتیپ کاشان تلقیح با هر دو گونه قارچ نسبت ریشه به ساقه را افزایش داد و به نظر می‌رسد که تلقیح توسط دو گونه قارچ میکوریز باعث افزایش بیشتری در وزن اندام زیرزمینی گیاه نسبت به افزایش وزن خشک اندام هوایی گیاه M. spicata شده است (شکل 2).

 

 

 

شکل 1- تصویر میکروسکوپی از وزیکول‌های موجود در ریشه نعنا تلقیح شده با قارچ میکوریز آربوسکولار

 

 

شکل 2- تأثیر تلقیح قارچی بر میزان وزن تر ساقه (A)؛ وزن تر ریشه (B)؛ نسبت وزن خشک ریشه به وزن خشک ساقه (C). سه ژنوتیپ از
M. spicata: گیاهچه‌های شاهد (con)، گیاهچه‌های تلقیح شده با قارچ mosseae F. (FM)، گیاهچه‌های تلقیح شده با قارچ F. etunicatum (FE). مقادیر میانگین 3 تکرار ± خطای استاندارد (SE) است. حروف غیرمشابه روی هر ستون نشان دهنده تفاوت معنی‌داری بر اساس آزمون LSD است.

 

 

تأثیر متقابل بین ژنوتیپ و قارچ برای شاخص‌های میزان اسانس و بیان ژن لیمونن‌سنتاز معنی‌دار بود. همزیستی موجب افزایش میزان اسانس در گیاهچه‌های تیمار شده با هر دو گونه قارچ Funneliformis در مقایسه با گیاهچه‌های شاهد شد. نتایج مقدار کل اسانس موجود در 100 گرم وزن خشک گیاه در شکل 3 نشان داده شده است. نتایج نشان داد که در هر سه ژنوتیپ بیشترین میزان اسانس در گیاهچه‌های تلقیح شده با قارچF. etunicatum حاصل شده است، این در حالی است که بالاترین میزان اسانس M. spicata در ژنوتیپ میبد به میزان 130 درصد بیشتر از شاهد به دست آمد.

نتایج حاصل از اندازه‌گیری بیان ژن لیمونن‌سنتاز در برگ‌های سه ژنوتیپ M. spicata نشان داد که تفاوت آشکاری در میزان بیان ژن دو ژنوتیپ کاشان و بجنورد در تلقیح با هر دو گونه قارچ F. etunicatumو
F. mosseae وجود ندارد. اما بیان ژن در ژنوتیپ میبد تلقیح شده با قارچ F. etunicatum نسبت به گیاهچه‌های شاهد و گیاهچه‌های تلقیح شده با قارچ mosseae F. افزایش نشان داد (شکل 4). بررسی روند تغییرات در غلظت اسانس و بیان ژن لیمونن‌سنتاز در برگ‌های ژنوتیپ میبد نشان داد که گیاهان با میزان اسانس بالا، بیان بالایی از ژن لیمونن‌سنتاز را نیز نشان می‌دهند. این ارتباط در دو ژنوتیپ دیگر معنی‌دار نبود به طوری که علیرغم افزایش غلظت اسانس در گیاهچه‌های تلقیح شده با هر دو قارچ، بیان ژن در برگ‌های این گیاهچه‌ها افزایشی نشان نداد.

 

 

   

شکل 3- تأثیر تلقیح قارچ بر میزان اسانس سه ژنوتیپ از
M. spicata. گیاهچه‌های شاهد (con)، گیاهچه‌های تلقیح شده با قارچ mosseae F. (FM)، گیاهچه‌های تلقیح شده با قارچ
F. etunicatum (FE). مقادیر میانگین 3 تکرار ± خطای استاندارد (SE) است. حروف غیرمشابه روی هر ستون نشان‌دهنده تفاوت معنی‌داری بر اساس آزمون LSD است.

شکل 4- تأثیر تلقیح قارچی بر بیان ژن لیمونن‌سنتاز سه ژنوتیپ ازM. spicata. گیاهچه‌های شاهد (con)، گیاهچه‌های تلقیح شده با قارچ mosseae F. (FM)، گیاهچه‌های تلقیح شده با قارچ
F. etunicatum (FE). مقادیر میانگین 3 تکرار ± خطای استاندارد (SE) است. حروف غیرمشابه روی هر ستون نشان‌دهنده تفاوت معنی‌داری بر اساس آزمون LSD است.

 


بحث.

در پژوهش حاضر، تلقیح دو گونه قارچ موجب افزایش شاخص‌های رشد در ریشه و اندام هوایی سه ژنوتیپ M. spicata شد. این افزایش رشد در گیاهان میکوریزی در مقایسه با انواع غیرمیکوریزی در گونه‌های متعددی گزارش شده است. پژوهش Turjaman و همکاران (2006) و Liu و همکاران (2007) نشان داد که تلقیح اندومیکوریزی علاوه بر افزایش رشد اندام هوایی سبب افزایش معنی‌دار در شاخص‌های رشد ریشه نیز شده است که با اندازه‌گیری وزن تر ریشه M. spicata تلقیح شده با قارچ میکوریز آربوسکولار و افزایش معنی‌داری آن نسبت به گیاهچه‌های شاهد همخوانی داشته است. Panwar (1991) در تحقیقی روی گندم تلقیح شده با قارچ میکوریز گزارش کرد که قارچ میکوریز، وزن تر و خشک ریشه و اندام هوایی را افزایش داده است. Miransari و همکاران (2009) نیز نشان دادند که یکی از علت‌های اصلی تأثیر افزایشی قارچ میکوریز بر رشد گیاهان ذرت، افزایش جذب مواد غذایی در گیاهان تلقیح شده است که این امر به دلیل شبکه گسترده هیف و افزایش حجم خاک احاطه شده توسط گیاه و در نتیجه افزایش جذب آب و مواد غذایی در آنها است. بهبود جذب عناصر معدنی به ویژه فسفر در گیاهان میزبان قارچ میکوریز آربوسکولار اغلب به پاسخ‌های رشدی مثبت در این گیاهان منجر می‌شود (Podila and Douds, 2000).

تشکیل اسانس و ترکیبات آن تحت تأثیر عوامل مختلف از جمله: شرایط اقلیمی، هورمون‌های رشد، فتوسنتز، تنوع فصول، تنش‌های زیستی و غیرزیستی، تعداد تریکوم و ... قرار دارد (Sajjadi, 2006). قارچ‌های اندومیکوریز با افزایش فعالیت‌های آنزیمی متفاوت سبب تغییرات فیزیولوژیک در گیاهان و متابولیت‌های ثانویه آنها می‌شوند (Mathur and Vyas, 1995). در سال‌های اخیر، مطالعاتی در زمینه سنتز متابولیت‌های ثانویه به واسطه تلقیح قارچ‌های میکوریز در گیاهان انجام شده است. برخی از این تحقیقات به سازوکار ترپنوئیدها در گیاهان میکوریزی اختصاص یافته است، برای نمونه، می‌توان به افزایش تولید روغن‌های فرار در گشنیز و شوید کلونیزه شده با قارچ F. fasiculatum
(Kapoor et al., 2002) و نعنا کلونیزه شده با همین قارچ (Freitas et al., 2004) اشاره کرد. همچنین، در مطالعات Gupta و همکاران (2002) روی M. spicata و Khaosaad و همکاران (2006) در مرزنجوش (Origamum vulgare) مشخص شد که کاربرد قارچ میکوریزی سبب افزایش چشمگیر میزان اسانس در مقایسه با شاهد می‌شود که با نتایج بررسی حاضر که تلقیح قارچ‌های mosseae F. و F. etunicatum تأثیرات مثبتی بر میزان اسانس در هر سه ژنوتیپ گیاه
M. spicata داشته است، همخوانی دارد.

پژوهشگران نشان داده‌اند که وزن ریشه‌ها و ساقه‌ها و تولید ترپنوئید در Euphorbia pekinensis پس از آغشتگی با قارچ‌های میکوریز افزایش یافته است (Yuan et al., 2010). الیسیتورهایی از برخی قارچ‌های میکوریز آربوسکولار جدا شده است که موجب افزایش زیست‌توده و القای ترپنوئیدها می‌شوند. به نظر می‌رسد آغشتگی گیاهان با قارچ‌های میکوریز و اندوفیت افزایش شارش متابولیک مسیر MEP (متیل اریتروتول فسفات) را به دنبال دارد (Wang et al., 1995). مطالعات Peipp و همکاران (1997) نشان داد که تلقیح قارچ‌های F. intraradices در جو می‌تواند تجمع متابولیت‌های ثانویه نظیر مشتقات سزکویی ترپنوئید را در ریشه‌ها القا ‌کند. بررسی داده‌های حاصل از آنالیز واریانس نشان داد که تأثیر ژنوتیپ و قارچ و نیز تأثیر متقابل آن دو بر بیان نسبی ژن لیمونن‌سنتاز معنی‌دار بود. لیمونن از ساده‌ترین مونوترپن‌های حلقوی است که در اسانس بسیاری از گیاهان وجود دارد. تولید نخستین حد واسط مسیر بیوسنتز اسانس‌ها یعنی لیمونن واکنشی است که مرحله محدود کننده سرعت این مسیر را کاتالیز می‌کند. مونوترپن سنتازها در مراحل تنظیمی مسیر بیوسنتزی، به دلیل مشخص نمودن نقاط انشعاب مسیر متابولیکی و کاتالیز نخستین مرحله منتهی به تشکیل تیره‌های مونوترپنی متفاوت، مهم هستند. بنابراین، هر گونه دست‌ورزی در بیان ژن‌های آنها می‌تواند موجب تغییر ترکیبات موجود در روغن‌های فرار گیاهی (نظیر عطر و اسانس) یا تولید مونوترپن‌ها در اندام‌هایی از گیاه که آنها را تولید نمی‌کنند یا حتی تولید در گونه‌هایی که فاقد آنها هستند، شوند. تاکنون در این زمینه تحقیقات اندکی در مورد گونه‌های معطر انجام گرفته است. لیمونن‌سنتاز (به عنوان یک مونوترپن سنتاز) یک آنزیم سیکلاز در مسیر بیوسنتزی برخی ترکیب‌های روغن فرار به شمار می‌رود که واکنش تبدیل ژرانیل دی فسفات به لیمونن را کاتالیز می‌کند (Munoz-Bertomeu et al., 2008). بررسی‌های اندکی در مورد ژن لیمونن‌سنتاز (LS) در گیاهان مختلف صورت گرفته است و تأثیر برخی تیمارها بر بیان این ژن بررسی شده است. برای نمونه، بیان ژن لیمونن‌سنتاز در گیاه .Cuminum cyminum L در تیمار غلظت‌های مختلف منگنز در غلظت80 قسمت در میلیون آن افزایش یافته است (Zarinkamar et al., 2012). همچنین، گزارش شده است که عوامل مختلف بر بیان این ژن مؤثر هستند از جمله Ghannadnia و همکاران (2011) گزارش کردند که بیان ژن لیمونن‌سنتاز در اندام‌ها و مراحل نموی مختلف گیاه زیره سبز متفاوت است. نتایج حاصل از بررسی بیان ژن لیمونن‌سنتاز در برگ سه ژنوتیپ مطالعه شده در شرایط بدون تلقیح و تلقیح با قارچ‌هایF. etunicatum و mosseae F. نشان داد که لیمونن‌سنتاز در ژنوتیپ‌های بررسی شده در شرایط شاهد و تلقیح با mosseae F.، بیان درخور توجهی نداشت. این ژن در تلقیح با قارچ F. etunicatum نیز در مقایسه با شرایط شاهد، فقط در ژنوتیپ میبد افزایش معنی‌دار داشت. Walter و همکاران در سال 2002 در تحقیقی روی بیان ژن DXS2 (1-داکسی دی گزیلولوز 5-فسفات سنتاز) در مسیر سنتز ایزوپرونوییدها بیان کردند که بیان ژن DXS2 در ریشه‌های تلقیح شده با قارچ میکوریز آربوسکولار به شدت تحریک می‌شود که با تجمع کارتنوییدها و اپوکارتنوییدها در ریشه این گیاه مرتبط است. مشخص شده است که در گیاهان میکوریزی القا شدیدی در سطح رونویسی cDNA دو آنزیم کد کننده DXS2 (1- داکسی-دی گزیلولوز 5- فسفات سنتاز) و DXR (1- داکسی-دی گزیلولوز 5- فسفات رداکتوایزومراز اتفاق می افتد (Walter et al., 2000). در پژوهش Blilou و همکاران (2000) بیان کردند که بیان دو ژن pal (فنیل آلانین آمونیالیاز) و lpt
(lipid protein transfer) در ریشه برنج تلقیح شده با قارچF. mosseae افزایش داشته است و این دو ژن در سیستم دفاعی گیاه نقش دارند. در تحقیق حاضر نیز بین روند تغییرات بیان ژن و روند افزایش میزان اسانس در ژنوتیپ میبد همخوانی وجود داشت، به طوری که ژنوتیپ میبد تلقیح شده با F. etunicatum که بالاترین بیان ژن را دارد، بیشترین میزان اسانس را داشت. بنابراین، می‌توان گفت که علاوه بر عوامل متعدد مؤثر بر میزان اسانس نظیر افزایش جذب عناصر غذایی در ریشه گیاهان میکوریزی احتمالاً بیان بالای ژن لیمونن‌سنتاز در این ژنوتیپ نیز در تنظیم مقدار اسانس گیاه M. spicata نقش داشته است. در دو گیاه
M. piperita و M. arvensis تراریخت شده با ژن لیمونن‌سنتاز، در ترکیباتی که به طور مستقیم از ژرانیل دی فسفات شکل می‌گیرند نظیر cineole و همچنین محصولات نهایی سنتز مونوترپن‌ها مانند پولیگون‌ها تغییراتی مشاهده شده است که دلیلی بر قابلیت تغییر محتوای اسانس در گیاهان تراریخت شده با لیمونن‌سنتاز است (Demir et al., 2001). در پژوهش دیگری روی گیاه نعنا فلفلی مشخص شد که بیان ژن لیمونن‌سنتاز تحت تأثیر اشعه UV-B تغییر می‌کند، آنها همچنین بیان کردند که بین بیان ژن و محتوای اسانس رابطه‌ای وجود ندارد (Dolzhenko et al., 2010). Mahmoud و همکاران (2004) گزارش کردند که در گیاه نعنا فلفلی تراریخت شده با لیمونن‌سنتاز هیچ تغییری در میزان اسانس تریکوم‌های غده‌ای و همچنین مونوترپن‌های موجود در اسانس وجود ندارد. فقدان ارتباط بین بیان ژن لیمونن‌سنتاز و محتوای اسانس در سایر ژنوتیپ‌های گیاه M. spicata را می‌توان به سرعت‌های مختلف انتشار اسانس از ساختارهای ترشحی نسبت داد، بنابراین می‌توان استنباط کرد بیان ژن هم در مرحله رونوشت‌برداری و هم پس از آن (ترجمه و پس از آن) قابل تنظیم است (Gershenzon et al., 2000؛ (McConkey et al., 2000. بر اساس پژوهش حاضر و پژوهش‌های پیشین همچنان نکات مبهم بسیاری در ارتباط با سازوکار بیان ژن لیمونن‌سنتاز تحت تأثیر عوامل مختلف و شناخت عوامل مختلف در تنظیم بیان ژن و به دنبال آن اسانس و محتوای اسانس حاصل از گیاه وجود دارد که این مسأله بر لزوم انجام تحقیقات بیشتر تأکید دارد.

 

نتیجه‌گیری.

نتایج حاصل از این تحقیق نشان داد که تلقیح گیاه M. spicata با قارچ‌های میکوریز آربوسکولار دارای آثار مثبتی بر میزان اسانس و بیان ژن در سه ژنوتیپ این گیاه است و این افزایش عملکرد در ژنوتیپ‌های تلقیح شده با قارچ F. etunicatum به ویژه در ژنوتیپ میبد کارآیی بالاتری داشته است.

 

سپاسگزاری.

نگارندگان از حمایت معاونت پژوهشی دانشگاه شهرکرد قدردانی می‌نمایند.

 

Ahmadi-Khoei, M., Shabani, L. and Bagheri, S. (2012) Assay of phenolic compounds and essential oils in mycorrhizal mint genotypes. Iranian Journal of Plant Biology 5(18): 81-94 (in Persian).

Almeida, P. P., Mezzomo N. and Ferreira, S. R. S. (2012) Extraction of Mentha spicata L. volatile compounds: evaluation of process parameters and extract composition. Food and Bioprocess Technology 5(2): 548-559.

Bakkali, F., Averbeck, S., Averbeck, D. and Idaomar, M. (2008) Biological effects of essential oils. Food and Chemical Toxicology 46(2): 446-475.

Blilou, I., Ocampo, A. J. and Garcia-Garrido, M. J. (2000) Induction of Ltp (transfer protein lipid) and Pal (phenylalanine ammonia-lyase) gene expression in rice root colonized by the arbuscular mycorrhizal fungus Glomus mosseae. Journal of Experimental Botany 51(353): 1969-1977.

Demir, S. (2004) Influence of arbuscular mycorrhiza on some physiological growth parameters of pepper. Turkish Journal of Biology 28: 85-90.

Dolzhenko, Y., Bertea, C. M., Occhipinti, A., Bossi, S. and Maffei, M. E. J. (2010) UV-B modulates the interplay between teerpenoids and flavonoids in peppermint (Mentha x piperita L.). Photochemistry and Photobiology B 100: 67-75.

Freitas, M. S. M., Martins, M. A. and Vieira, E. (2004) Yield and quality of essential oils of Mentha arvensis in responseto inoculation with arbuscular mycorrhizal fungi. Pesquisa Agropecuária Brasileira 39: 887-894.

Gershenzon, J., Mcconkey, M. E. and Croteau, R. B. (2000) Regulation of monoterpene accumulation in leaves of peppermint. Plant Physiology 122(1): 205-214.

Ghannadnia, M., Haddad, R., Zarinkamar, F. and Sharifi, M. (2011) Different expression of limonene synthase gene in organs and developmental stages of cumin (Cuminum cyminum L.). Iranian Journal of Medicinal and Aromatic Plants 27(3): 495-508 (in Persian).

Gupta, M., Prasad, A., Ram, M. and Kumar, S. (2002) Effect of the vesicular-arbuscular mycorrhizal (VAM) fungus Glomus fasciculatum on the essential oil yield related characters and nutrient acquisition in the crops of different cultivars of menthol mint (Mentha arvensis) under field conditions. Bioresource Technology 81(1): 77-79.

Kapoor, R., Giri, B. and Mukerji, K. G. (2002) Effect of the vesicular arbuscular mycorrhizal (VAM) fungus Glomus fascilucatum on the essential oil yield related characters and nutrient acquisition in the crops of different cultivars of menthol mint (Mentha arvensis) under field conditions. Bioresource Technology 81: 77-79.

Khan, N. I., Tisserat, B., Berhow, M. and Vaughn, S. F. (2005) Influence of autoclaved fungal materials on spearmint (Mentha spicata L.) growth, morphogenesis and secondary metabolism. Journal of Chemical Ecology 31(7) 1579-1593.

Khaosaad, T., Vierheilig, H., Nell, M., Zitterl-Eglseer, K. and Novak, J. (2006) Arbuscular mycorrhiza alter the concentration of essential oils in oregano (Origanum sp.,Lamiaceae). Mycorrhiza 16(6): 443-446.

Li, X., Niu, X., Bressan, R. A., Weller, S. C. and Hasegawa, P. M. (1999) Efficient plant regeneration of native spearmint (Mentha spicata L.). In Vitro Cellular and Developmental Biology-Plant 35(4): 333-338.

Liu, J., Wu, L., Wei, S., Xiao, X., Su, C., Jiang, P., Song, Z., Wang, T. and Yu, Z. (2007) Effects of arbuscular mycorrhizal fungi on the growth, nutrient uptake and glycyrrhizin production of licorice (Glycyrrhiza uralensis Fisch). Journal of Plant Growth Regulation 52(1): 29-39.

Livak, K. J. and Schmittgen, T. D. (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2- ΔΔCT method. Methods 25: 402-408.

Mahmoud, S. S., Williams, M. and Croteau, R. (2004) Cosuppression of limonene-3-hydroxylase in peppermint promotes accumulation of limonene in the essential oil. Phytochemistry 65(5): 547-554.

Mathur, N. and Vyas, A. (1995) Changes in isozyme patterns of peroxidase and polyphenol oxidase by VAM fungi in roots of Ziziphus species. Plant Physiology 4: 498-500.

McConkey, M. E., Gershenzon, J. and Croteau, R. B. (2000) Developmental Regulationof monoterpenebiosynthesis in the glandular trichomes of peppermint. Plant Physiology 122: 215-223.

Miransari, M., Bahrami, H., Rejali, F. and Malakouti, M. (2009) Effects of soil compaction and arbuscular mycorrhiza on corn (Zea mays L.) nutrient uptake. Soil and Tillage Research 103(2): 282-290.

Munoz-Bertomeu, J., Ros, R., Arrillaga, I. and Segura, J. (2008) Expression of spearmint limonene synthase in transgenic spike lavender results in an altered monoterpene composition in developing leaves. Metabolic Engineering 10(3): 166-177.

Panwar, J. (1991) Effect of VAM and Azospirillum brasilense on photosynthesis, nitrogen metabolism and grain yield in wheat. Indian Journal of Plant Physiology 34(4): 357-361.

Peipp, H., Maier, W., Schmidt. J., Wray, V. and Strack, D. (1997) Arbuscular mycorrhizal fungus- induced changes in the accumulation of secondary compounds in barley roots. Phytochemistry 44: 581-587.

Podila, G. K. and Douds, D. D. (2000) Current advances in mycorrhizae research. APS Press, Saint Paul.

Sajjadi, S. E. (2006) Analysis of the essential oils of two cultivated Basil (Ocimum basilicum L.) from Iran. Daru Journal of Pharmaceutical Sciences 14(3):128-130.

Silveria, S. V., Lorscheiter, R., Barros, I. B. I., Schwraz, S. F. and Souza, P. V. D. (2006) Mentha piperita as a multiplying of arbuscular mycorrhizal fungi. Botucatu 8: 91-97.

Strack, D., Fester, T., Hause, B., Schliemann, W. and Walter, M. H. (2003) Arbuscular mycorrhiza: biological, chemical and molecular aspects. Journal of Chemical Ecology 29(9):1955-1979.

Turjaman, M., Tamai, Y., Santoso, E., Osaki, M. and Tawaraya, K. (2006) Arbuscular mycorrhizal fungi increased early growth of two nontimber forest product species Dyera polyphylla and Aquilaria filaria under greenhouse conditions. Mycorrhiza 16(7): 459-464.

Walter, M. H., Hans, J. and Strack, D. (2002) Two distantly related genes encoding 1-deoxy-D- xylulose 5-phosphate synthases: differential regulation in shoots and apocarotenoid-accumulating mycorrhizal roots. The Plant Journal 31(3): 243-254.

Wang, Zh., Nishioka, M., Kurosaki, Y., Nakayama, T. and Kimura, T. (1995) Gastrointestinal absorption characteristics of glycyrrhizin from Glycyrrhiza extract. Biological and Pharmaceutical Bulletin 18: 1238-1241.

Yuan, Z. L., Dai, C. and Chen, L. (2010) Regulation and accumulation of secondary metabolites in plant-fungus symbiotic system. African Journal of Biotechnology 6: 1266-1271.

Zare Dehabadi, S. and Asrar, Z. (2009) Study on the effects of zinc stress on induction of oxidative stress and concentration of mineral element in spearmint (Mentha spicata L.). Iranian Journal of Biology 22(2): 218-228 (in Persian).

Zarinkamar, F., Ghannadnia, M. and Haddad, R. (2012) Limonene synthase gene expression under different concentrations of manganese in Cuminum cyminum L. African Journal of Plant Science 6(6): 203-212.