بررسی تغییرات بیان ژن‌های دفاعی گیاه گندم در پاسخ به آلودگی به Mycosphaerella graminicola

نوع مقاله: مقاله پژوهشی

نویسندگان

1 گروه محیط‌زیست، دانشکدۀ کشاورزی و منابع طبیعی، دانشگاه اردکان، اردکان، ایران

2 پژوهشکدۀ بیوتکنولوژی کشاورزی، پژوهشگاه ملی مهندسی ژنتیک و زیست‌فناوری، تهران، ایران

3 بخش بیماری‌شناسی گیاهی، دانشکدۀ کشاورزی، دانشگاه تربیت مدرس، تهران، ایران

چکیده

هدف از انجام پژوهش حاضر، بررسی تأثیر غلظت‌های متفاوت سالیسیلیک اسید بر میزان بیان ژن‌های رمزکنندۀ چهار آنزیم فنیل‌آلانین آمونیالیاز، پلی‌فنل اکسیداز، پراکسیداز و کاتالاز در گیاه گندم (رقم متحمل زاگرس) در بر‌هم کنش با قارچ بیماری‌زای Mycosphaerella graminicolaبود. به این‌منظور، گیاه گندم در مرحلۀ دو برگی با سالیسیلیک اسید (SA) تلقیح و سپس با قارچ عامل بیماری مایه‌زنی شد. نمونه‌برداری از این گیاهان در پنج نقطۀ زمانی (0، 3، 6، 12 و 24 ساعت) پس از مایه‌زنی قارچ بیماری‌زا انجام شد. سپس میزان بیان ژن‌های رمزکنندۀ این آنزیم‌ها با روش نوردرن بلات معکوس بررسی شد. مقدار بیان ژن رمزکنندۀ هر چهار آنزیم، بر اثر مایه‌زنی با قارچ بیماری‌زا و سالیسیلیک اسید، از نخستین نقطۀ زمانی پس از مایه‌زنی در این رقم از گندم افزایش و تفاوت معنی‌دار داشت. تأثیر سالیسیک اسید بر افزایش بیان ژن آنزیم‌های فنیل‌آلانین آمونیالیاز و پراکسیداز در همة نقاط زمانی مثبت بود. افزایش سالیسیلیک اسید پس از 12 ساعت بر بیان ژن آنزیم پلی فنل اکسیداز مؤثر بود. سالیسیلیک اسید روند جهشی بیان ژن کاتالاز را 12 ساعت پس از آلودگی با قارچ باعث شد؛ اما این تأثیر تا ساعت 24 تداوم نداشت. بر اساس نتایج این پژوهش برای اینکه گیاه بتواند در برابر تهاجم عوامل بیماری‌زا مصون بماند باید بیان ژن‌های دفاعی در ساعات ابتدایی پس از تلقیح قارچ بیماری‌زا افزایش پیدا کند. از سویی افزایش بیان این ژن‌ها با افزایش میزان فعالیت آنزیم‌های متناظر ارتباط مستقیم دارد که نشان‌دهندۀ نقش مستقیم ژن‌های دفاعی در فعالیت‌های سیستم دفاعی گیاه است. در پژوهش حاضر، از رقم مقاوم زاگرس استفاده شد، لذا افزایش زودهنگام بیان ژن‌ها، پدیده‌ای قابل توجیه در ساز‌و‌کار مقاومت گیاه در برابر عامل بیماری‌زا به نظر می‌رسد.

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Study of defense genes expression profile pattern of wheat in response to infection by Mycosphaerella graminicola

نویسندگان [English]

  • Jalal Gholamnezhad 1
  • Forough Sanjarian 2
  • Ebrahim Mohammadi Goltapeh 3
  • Naser Safaie 3
  • Khadijeh Razavi 2
1 Faculty of Agriculture and Natural Resources, Ardakan University, Ardakan, Iran
2 Agriculture Biotechnology Institute, National Institute of Genetic Engineering and Biotechnology, Tehran, Iran
3 Department of Plant Pathology, Tarbiat Modarres University, Tehran, Iran
چکیده [English]

The aim of this study was to examine the effect of salicylic acid on the gene expression pattern of four enzymes; Phenylalanine ammonialyase, Polyphenol oxidase, Peroxidase and Catalase in wheat-Mycosphaerella graminicola pathosystem. For this reason, Salicylic Acid (2mm) were sprayed on wheat in two-leaf stage before inoculation with the fungal pathogen. Sampling of the plants was done at five time points (0, 3, 6, 12 and 24 h) after inoculation. The scanning of genes expression pattern of encoding enzymes were carried out by reverse northern dot blotting method. The results showed that within 24 hours post inoculation the gene expression of these enzymes significantly increased in this tolerant cultivar. SA enhanced the expression of Phenylalanine ammonialyase and Peroxidase genes in all time points. The expression of Polyphenol oxidase was increased by SA after 12h. On the other hand, increasing the expression level of these genes directly increases the activity of the enzymes which indicates direct role of these gens in plant defense system. SA caused a rapid rise in expression of Catalase gene, but this effect was not continued for 24h.

کلیدواژه‌ها [English]

  • Antioxidant Enzymes
  • Gene expression pattern
  • Mycosphaerella graminicola
  • Salicylic acid

بررسی تغییرات بیان ژن‌های دفاعی گیاه گندم
در پاسخ به آلودگی به
Mycosphaerella graminicola

 

جلال غلام‌نژاد 1*، فروغ سنجریان 2، ابراهیم محمدی گل‌تپه 3، ناصر صفایی 3 و خدیجه رضوی 2

1 گروه محیط‌زیست، دانشکدۀ کشاورزی و منابع طبیعی، دانشگاه اردکان، اردکان، ایران

2 پژوهشکدۀ بیوتکنولوژی کشاورزی، پژوهشگاه ملی مهندسی ژنتیک و زیست‌فناوری، تهران، ایران

3 بخش بیماری‌شناسی گیاهی، دانشکدۀ کشاورزی، دانشگاه تربیت مدرس، تهران، ایران

 

چکیده

هدف از انجام پژوهش حاضر، بررسی تأثیر غلظت‌های متفاوت سالیسیلیک اسید بر میزان بیان ژن‌های رمزکنندۀ چهار آنزیم فنیل‌آلانین آمونیالیاز، پلی‌فنل اکسیداز، پراکسیداز و کاتالاز در گیاه گندم (رقم متحمل زاگرس) در بر‌هم کنش با قارچ بیماری‌زای Mycosphaerella graminicolaبود. به این‌منظور، گیاه گندم در مرحلۀ دو برگی با سالیسیلیک اسید (SA) تلقیح و سپس با قارچ عامل بیماری مایه‌زنی شد. نمونه‌برداری از این گیاهان در پنج نقطۀ زمانی (0، 3، 6، 12 و 24 ساعت) پس از مایه‌زنی قارچ بیماری‌زا انجام شد. سپس میزان بیان ژن‌های رمزکنندۀ این آنزیم‌ها با روش نوردرن بلات معکوس بررسی شد. مقدار بیان ژن رمزکنندۀ هر چهار آنزیم، بر اثر مایه‌زنی با قارچ بیماری‌زا و سالیسیلیک اسید، از نخستین نقطۀ زمانی پس از مایه‌زنی در این رقم از گندم افزایش و تفاوت معنی‌دار داشت. تأثیر سالیسیک اسید بر افزایش بیان ژن آنزیم‌های فنیل‌آلانین آمونیالیاز و پراکسیداز در همة نقاط زمانی مثبت بود. افزایش سالیسیلیک اسید پس از 12 ساعت بر بیان ژن آنزیم پلی فنل اکسیداز مؤثر بود. سالیسیلیک اسید روند جهشی بیان ژن کاتالاز را 12 ساعت پس از آلودگی با قارچ باعث شد؛ اما این تأثیر تا ساعت 24 تداوم نداشت. بر اساس نتایج این پژوهش برای اینکه گیاه بتواند در برابر تهاجم عوامل بیماری‌زا مصون بماند باید بیان ژن‌های دفاعی در ساعات ابتدایی پس از تلقیح قارچ بیماری‌زا افزایش پیدا کند. از سویی افزایش بیان این ژن‌ها با افزایش میزان فعالیت آنزیم‌های متناظر ارتباط مستقیم دارد که نشان‌دهندۀ نقش مستقیم ژن‌های دفاعی در فعالیت‌های سیستم دفاعی گیاه است. در پژوهش حاضر، از رقم مقاوم زاگرس استفاده شد، لذا افزایش زودهنگام بیان ژن‌ها، پدیده‌ای قابل توجیه در ساز‌و‌کار مقاومت گیاه در برابر عامل بیماری‌زا به نظر می‌رسد.

واژه‌های کلیدی: سالیسیلیک اسید، الگوی بیان ژن، آنزیم‌های اکسیداتیو، گندم، Mycosphaerella graminicola



مقدمه.

گندم غذای اصلی حدود 35 % جمعیت جهان را تشکیل داده است و پیش‌بینی می‌شود در سال 2020، تقاضای جهانی برای این محصول بین840 تا 1050 میلیون تن باشد. برای رسیدن به این سطح تقاضا، تولید این محصول باید سالانه 6/1 تا 6/2% افزایش پیدا کند (Chartrain et al., 2004). گیاه گندم در مدت کشت تا برداشت، در معرض تنش‌های محیطی زنده و غیرزندة مختلفی مانند بیماری‌ها و خشکی قرار می‌گیرد که رشد گیاه را محدود می‌کند. در گندم نیز مانند سایر گیاهان، ساز‌و‌کار‌های مختلفی برای سازش با این تغییرات و حفظ بقای گیاه تکامل یافته است که از آن جمله می‌توان به ساز‌و‌کارهای مورفولوژیک، فیزیولوژیک و تغییرات مولکولی اشاره کرد (Kia and Torabi, 2008).

بیماری سوختگی برگ گندم (سپتوریوز برگی) از مهم‌ترین بیماری‌های گندم در جهان است که سالیانه خسارات فراوانی را به محصول گندم وارد می‌کند (Goodwin et al., 2003). عامل این بیماری قارچ بیماری‌زای Mycosphaerella graminicola (Fuckel) J.Schröt.in Cohen با شکل غیرجنسی Zymoseptoria triticiاست (Quaedvlieg et al., 2011). گزارش‌هایی مبنی بر بروز اپیدمی‌های بیماری در بعضی از استان‌ها از جمله گلستان، خوزستان و فارس وجود دارد. میزان کاهش محصول ناشی از خسارت این بیماری بر تعدادی از ارقام متداول، در استان‌های خوزستان و گلستان تا حدود 44% برآورد شده است (Kia and Torabi, 2008). کنترل این بیماری با قارچ‌کش، به‌کاربردن ارقام مقاوم و همچنین با روش‌های زراعی (تناوب زارعی و از بین بردن بقایای گیاهان آلوده) است (Adhikari et al., 2007). تلاش‌هایی نیز برای کنترل زیستی این قارچ انجام گرفته است که هنوز به نتایج کاربردی در مزرعه منجر نشده است(Zamani et al., 2016; Lynch et al., (2016; Gholamnezhad et al., 2012. با توجه به ناکارآمدی روش‌های زراعی در مهار موثر بیماری، مقاومت جدایه‌های قارچ به سموم سیستمیک، هزینه‌ها و آلودگی ناشی از مصرف سموم شیمیایی؛ استفاده از ارقام مقاوم، اقتصادی‌ترین، بهترین و از نظر زیست‌محیطی، سالم‌ترین روش مقابله با این بیماری است (Berraies et al., 2013).

تأثیر قوی رقم گندم بر بیان ژن‌های بیماری‌زایی
M. graminicolaبا مطالعات نسل جدید توالی‌یابی (next generation sequencing) مشخص شده است (McDonald et al., 2016). تفاوت اصلی گیاه حساس و مقاوم، شناسایی به موقع بیماری‌زای مهاجم و فعال‌سازی سریع و موثر ساز‌و‌کار‌های دفاعی گیاه مقاوم است. ژن‌های فراوانی در پاسخ گیاه به بیماری‌زا، فعال یا خاموش می‌شوند. همچنین ممکن است بیان آن‌ها افزایش یا کاهش یابد. بررسی بیان متمایز ژن‌ها یکی از روش‌های مهم برای مشخص‌کردن اساس زیستی سیستم‌های بیولوژیک است (Wang et al., 2009).

دانش ژنتیک مقاومت، برای اصلاح گندم مقاوم به بیماری لکة برگی گندم اهمیت زیادی دارد. مقاومت ژنتیکی در ارقام مختلف به دو شکل کمی و کیفی گزارش شده است (Vakili Bastam et al., 2010). تحقیقات در این زمینه نشان می‌دهد که مقاومت در برابر این بیماری با ژن‌های بارز کنترل می‌شود (Boukef et al., 2012). وجود تخصص‌یافتگی فیزیولوژیک در بیماری‌زای M. graminicola و رابطة ژن برای ژن در این پاتوسیستم، سال‌ها پیش به اثبات رسید و تعداد 18 ژن مقاومت (Stb1-Stb18) به بیماری سپتوریای برگی در ژنوتیپ‌های مختلف گندم مکان‌یابی شد (Arraiano et al., 2007).

برادینگ و همکاران در سال 2002 با بررسی مقاومت ویژة چند رقم گندم حساس و مقاوم و ژن‌های کنترل‌‌کنندة مقاومت آن‌ها در مقابل جدایه‌های عامل بیماری لکة برگی سپتوریایی، بر رابطة ژن برای ژن بین مقاومت اختصاصی گندم و بیماری‌زایی
M. graminicola تأکید کردند. مقاومت به این بیماری ممکن است کمّی یا اختصاصی باشد. مقاومت اختصاصی، تقریباً کامل و الیگوژنیک است و از رابطۀ ژن برای ژن تبعیت می‌کند (Brading et al., 2002).

سالیسیلیک اسید (SA) تنظیم‌کنندة طبیعی رشد گیاه است. علاوه بر‌این، گیاهان مقدار داخلی این ماده را در برابر بیماری‌زایهای مختلف افزایش می‌دهند. استفاده از SA خارجی برای القای مقاومت به بیماری‌زای‌های ویروسی، باکتریایی و قارچی در گیاهان بسیاری آزموده شده و تاثیر مثبت داشته است (Hayat et al., 2010).

در این مطالعه، بیان ژن‌های دفاعی که نقش مهمی در فرایند پاسخ به تنش در گیاه و به خصوص در متحمل بازی می‌کنند، در پاتوسیستم گندم - M. graminicola با روش نوردرن بلات معکوس مورد بررسی قرار گرفته است. بازة زمانی برداشت نمونه تا 24 ساعت اولیه پس از آلودگی بود تا گیاه با پاسخ سریع به عامل بیماری‌زا از ایجاد بیماری جلوگیری کند که این پاسخ سریع با افزایش بیان ژن‌های مختلف از جمله ژن‌های دفاعی انجام می‌شود. اگر گیاه نتواند واکنش سریع نشان دهد، عامل بیمار‌ی‌زا با گذشت زمان غلبه می‌کند؛ در‌نتیجه گیاه بیمار می‌شود (Ray et al., 2003; Adhikari et al., 2007). نوردرن بلات معکوس، یکی از روش‌هایی است که اطلاعات توالی (ژنومیکس ساختاری) را به ژنومیکس عملکردی (‌تعیین عملکرد و نوع فعالیت) ربط می‌دهد (Rabbani et al., 2003). هدف اصلی از این مطالعه نشان‌دادن افزایش بیان ژن‌های دفاعی در رقمی نسبتاً مقاوم است که متعاقباً افزایش سیستم‌های دفاعی گیاه را باعث می‌شود. در این مطالعه تأثیر غلظت‌های متفاوت سالیسیلیک اسید (عامل القای سیستم دفاعی) بر میزان بیان ژن‌های رمز‌کنندة چهار آنزیم فنیل‌آلانین آمونیالیاز (PAL)، پلی‌فنل‌اکسیداز (PPO)، پراکسیداز (POX) و کاتالاز (CAT) در رقم متحمل زاگرس از گیاه گندم در بر‌هم‌کنش با قارچ بیماری‌زا بررسی شد.

 

مواد و روش‌‌ها.

کشت گیاهان و ایجاد تنش بیماری‌زا: در تحقیق حاضر، رقم گندم زاگرس استفاده شد. اصلاحی و همکاران این رقم را متحمل به قارچ بیماری‌زا
M. graminicola تشخیص دادند (Esllahi et al., 2013). بذرها پس از استریل‌شدن با الکل 70% به‌مدت 30 ثانیه و دو بار شستشو با آب مقطر استریل، در عمق 1 سانتی‌متری خاک گلدان (محتوی پرلیت، خاک سترون و خاک‌برگ با نسبت 1:1:1) کشت شدند. در هر گلدان سه بذر کاشته شد و گلدان‌ها در شرایط 16 ساعت نور و هشت ساعت تاریکی و دمای 23 درجة سانتیگراد روز و 18 درجۀ‌سانتیگراد شب نگهداری شدند. گیاهچه‌ها در مرحلۀ دوبرگی (12روزه‌گی)‌ با سوسپانسیون جدایۀ قارچ بیماری‌زا به روش Chartrain و همکاران (2004) تلقیح‌شدند. هم‌زمان، این گیاهان با سالیسیلیک اسید در غلظت‌های (0 و 2 میلی‌مولار) محلول‌پاشی شدند. غلظت‌ها براساس مطالعة انجام‌شدة قبلی نگارندگان در گلخانه با همین رقم و عامل بیماری، انتخاب شد (Gholamnezhad et a.l, 2012). گیاهان شاهد تنها با آب مقطر استریل تلقیح شدند. برای بررسی پاسخ‌های اولیه و سریع گیاه، در زمان‌های 0، 3، 6، 12 و 24 ساعت پس از مایه‌زنی قارچ بیماری‌زا، نمونه‌برداری از برگ‌های گیاه گندم انجام شد. نمونه‌ها بلافاصله در محل نمونه‌برداری به ظرف نیتروژن مایع منتقل و سپس در فریزر70- درجۀ سانتیگراد آزمایشگاه ذخیره شدند. آزمایش در قالب طرح کاملاً تصادفی در سه تکرار انجام شد و شامل دو سطح بیماری‌زا، دو سطح سالیسیلیک اسید و پنج سطح زمانی (مجموعا 20 تیمار) بود.

انتخاب ژن‌ها و طراحی آغازگر: در پژوهش حاضر، بیان ژن چهار آنزیم آنتی‌اکسیدانی پلی‌فنل اکسیداز با شماره شناسایی AY515506، فنیل‌آلانین آمونیالیاز با شماره شناسایی AEX59143، پراکسیداز با شماره شناسایی CAA39486 و کاتالاز با شماره شناسایی CAA64077، ارزیابی شد. توالی این ژن‌ها از بانک اطلاعاتی ژنوم (NCBI) به دست آمد و آغازگرهای اختصاصی طراحی شد (جدول 1). برای ژن خانه‌دار (کنترل داخلی) نیز از ژن آلفا توبولین استفاده شد.

استخراج RNA و ساخت cDNA: استخراج RNA از بافت اندام‌های هوایی گندم با کیت RNXplus (سیناژن، ایران) مطابق دستورالعمل انجام شد. برای ساخت cDNA حدود 5 میکروگرم از RNA استخراجی با مقدار 5/0 میکرولیتر آغازگرهای Oligo dT مخلوط شد و در دمای 65 درجة سانتیگراد به‌مدت 5 دقیقه قرار گرفت و سپس روی یخ، سرد شد. واکنش رونویسی معکوس در حضورThermo Scientific RiboLock RNase وReverse Transcriptase (Thermo Scientific، آمریکا) و dNTP به‌مدت 1 ساعت در دمای 42 درجۀ سانتیگراد انجام شد. در مرحلۀ پایانی برای غیرفعال‌کردن آنزیم واکنش، به‌مدت 10 دقیقه در دمای 70 درجۀ سانتیگراد قرار گرفت. با الگوی cDNA و آغازگرهای اختصاصی، هر ژن با واکنش PCR تکثیر شد. مقدار هر ژن از مقایسۀ میزان روشنایی باند محصول PCR روی ژل آگارز با میزان روشنایی باند متناظر نشانگر DNA در رنگ‌آمیزی با اتیدیوم بروماید و کمّی‌کردن آن با نرم‌افزار Totallab (Totallab، انگلیس) مشخص شد.

 

جدول 1- نام ژن‌ها و توالی آغازگرهای استفاده‌شده در نوردرن بلات معکوس

دمای ذوب درجۀ سانتیگراد

طول توالی

توالی آغازگر (′3-′5)

نام مخفف

نام ژن

60

271

F: AGGCTCACCTGGTTAAGTTC

CAT

کاتالاز

R: CAGTGGGATGATGTCCTCTG

60

248

F: AATCAGACCGTCTCCTGCG

POX

پراکسیداز

R: GGTGGTGTCGTTGTTGAAC

62

284

F: TTCTGTCCGTCCTTGCTGAG

PAL

فنیل آلانین آمونیالیاز

R: CAATGGGGGTGCCTTGGAAG

60

250

F: AACGACCAGCTCTCCAACAT

PPO

پلی‌فنل اکسیداز

R: AACAGGGATGTGTAGGTCAG

56

 

F:GCTTTCAACACCTTCTTCAG

α-Tub

آلفا – توبولین

R:GGGGCATAGGAGGAAAGCA

 

ساخت پروب نشان‌دار: در بررسی الگوی بیان ژن‌ها، از RNA استخراجی از گیاهان تیمار‌شده برای تهیۀ نشانگر (Probe) استفاده شد. مراحل تهیة پروب یا نشانگر نشاندار، مانند تهیه cDNA معمولی بود با این تفاوت که به جای استفاده از dNTP معمولی ازDIG labeled dNTP (Roche Life Science، آلمان) استفاده شد.

نوردرن بلات معکوس و بررسی بیان ژن‌ها: پس از بهینه‌سازی شرایط واکنش PCR، 5/0 تا 1 میکروگرم از محصول PCR هر ژن روی غشا لکه‌گذاری شد. محصول PCR ژن‌های انتخابی با محلول NaOH 1 میلی‌مولار و محلول 25/0 مولار NaCl واسرشت شدند و در دستگاه بلاتر 96 چاهکی روی غشا لکه‌گذاری شدند. پس از خشک‌شدن غشا در دمای اتاق، لکه‌ها به‌مدت 1 ساعت در دمای100 درجۀ‌سانتیگراد تثبیت شدند. از cDNA ژن آلفا- توبولین گندم برای کنترل داخلی و از آب مقطر و محلول واکنش PCR بدون الگو برای کنترل منفی استفاده شد. برای واسرشت‌کردن، نشانگرهای تهیه شده (cDNA نشاندارشده با DIG) به‌مدت 5 دقیقه در آب‌جوش و به دنبال آن 5 دقیقۀ دیگر روی یخ قرار داده شدند. پیش‌دورگه‌سازی غشا با 50 میلی‌لیتر از محلول پیش‌هیبریداسیون با 2/7 pH= (35 میلی‌لیتر SDS 7%، 100 میکرولیتر EDTA 1 میلی‌مولار و 5/12 میلی‌لیتر بافر فسفات 25/0 مولار) در دمای 65 درجۀ‌سانتیگراد به‌مدت 5/1 ساعت داخل دستگاه هیبریداسیون انجام شد. پس از تخلیة محلول پیش‌دورگه‌سازی، 50 میکرولیتر نشانگر واسرشته به 5 میلی‌لیتر محلول پیش‌هیبریداسیون اضافه شد و دورگه‌سازی به‌مدت یک شب در دمای 65 درجۀ‌سانتیگراد و داخل دستگاه هیبریداسیون انجام شد. پس از تخلیة مخلوط نشانگر و محلول دورگه‌سازی در لولة استریل و نگهداری آن در 20- درجۀ سانتیگراد، غشا سه مرتبه شستشو داده شد. شستشوی اول با محلول X2 SSC حاوی 1/0% SDS دو مرتبه به‌مدت 15 دقیقه در دمای اتاق انجام شد. شستشوی دوم غشا با محلول X5/0 SSC حاوی 1/0% از SDS یک بار به‌مدت 15 دقیقه در دمای 65 درجۀ سانتیگراد انجام شد و در شستشوی آخر، غشا با محلول X2/0 SSC بدون SDS به‌مدت 15 دقیقه در دمای اتاق شستشوشد. در مرحلۀ آخر، 10 میکرولیتر گهرمایة CDS-Star (Roche Life Science، آلمان) به غشای قرار گرفته در پاکت سلوفونی اضافه شد. سپس غشا در تاریک‌خانه در معرض فیلم رادیولوژی (X-ray) گذاشته شد و فیلم پس از 30 دقیقه ظاهر شد. امتیازدهی به لکه‌ها با نرم‌افزار TotalLab، که میزان تیرگی لکه‌ها را براساس تعداد نقاط تیرة موجود در محدودة لکة مد نظر مشخص می‌کند، انجام شد. پس از آنکه همة لکه‌ها با نرم‌افزار، براساس لکة آلفا - توبولین، استاندارد شدند، داده‌های حاصل از نرم‌افزار TotalLab وارد نرم‌افزار Excel شدند و با نرم افزار SAS ver.9 تجزیه و تحلیل شدند. میانگین مربوط به بیان هر ژن در قالب طرح کاملاً تصادفی با چهار تکرار (دو تکرار زیستی و دو تکرار روشی) تجزیة واریانس شد. پس از تجزیة واریانس برای هر ژن، مقایسة میانگین‌های مربوط به هر ژن با آزمون چند دامنه‌ای دانکن در سطح اطمینان 1% انجام شد.

 

 

نتایج.

براساس اطلاعات به‌دست‌آمده از غشاها (برای مثال شکل (1)، مربوط به آنزیم پلی‌فنل اکسیداز) در پاتوسیستم گیاهی مطالعه‌شده، بیان ژن آنزیم‌های بررسی‌شده، در دورۀ 24 ساعت نمونه‌برداری افزایش پیدا کرد. خلاصۀ تجزیة واریانس برای تغییرات بیان ژن‌های بررسی‌شده در حالت تیمار با قارچ بیماری‌زا و سالیسیلیک اسید در جدول (2) آمده است.

 

جدول 2- خلاصۀ تجزیة واریانس میزان تغییرات بیان ژن‌های بررسی‌شدة درگیر در برهم‌کنش گندم، و قارچ بیماری‌زای M. graminicola، در تیمارهای مختلف سالیسیلیک اسید. SA: سالیسیلیک اسید P: بیماری‌زا

PPO

PAL

POX

CAT

منابع تغییرات

میانگین مربعات

 

**4/631

**1681

**11/17

9/4135

تیمار

03/1

71/1

46/1

27/2

خطا

36/3

58/4

94/2

09/2

ضریب تغییرات (C.V)

 

شکل 1- تصویر درشت‌آرایه از پروفایل بیانی ژن PPO در تنش با قارچ و سالیسیلیک اسید. تیرگی لکه‌‌‌‌‌‌‌‌‌‌‌‌‌‌‌‌ها نشان‌دهندة مقدار cDNA نشان‌دار متصل‌شده به DNA ژن PPO تثبیت‌شده در کاغذ نیترو سلولز (مقدار بیان ژن) است. برای آنالیزهای نهایی، تیرگی لکه‌ها براساس لکة آلفا -توبولین با نرم‌افزار، استاندارد شدند.

 

بیان ژن رمزکنندۀ آنزیم فنیل‌آلانین‌آمونیالیاز (PAL) در طول 24 ساعت در هر دو تیمار قارچ و تیمار هم‌زمان قارچ و سالیسیلیک اسید (2SA+P) افزایش نشان داد. با اینکه افزایش بیان در هر دو تیمار، روندی مشابه داشت، مایه‌زنی هم‌زمان سالیسیلیک اسید و قارچ بیشتر از تلقیح با قارچ تنها، بر بیان این ژن تاثیر داشت که نشان‌دهندة بیان بیشتر آن در حضور سالیسیلیک‌اسید و قارچ بیماری‌زا در رقم مقاوم است (شکل 2-A).

بیان ژن رمزکنندۀ پلی‌فنل اکسیداز (PPO)در طول 24 ساعت در هر دو تیمار قارچ و تیمار هم‌زمان قارچ و سالیسیلیک اسید افزایش یافت. با اینکه افزایش بیان در هر دو تیمار از شش ساعت پس از تلقیح، با روند جهشی همراه شد و تا 24 ساعت پس از تلقیح ادامه یافت. در همۀ ساعات نمونه‌برداری بجز نقطۀ زمانی 24، بیان ژن رمزکنندة این آنزیم در تیمار با قارچ، اختلاف معنی‌داری با تیمار هم‌زمان قارچ و سالیسیلیک اسید نشان نداد (شکل 2-B).

بیان ژن رمز کنندۀ آنزیم پراکسیداز در مدت 24 ساعت در هر دو تیمار قارچ و آب مقطر و نیز تیمار هم‌زمان قارچ و سالیسیلیک اسید (2SA+P) افزایش یافت. روند افزایش بیان این ژن در هر دو تیمار سالیسیلیک اسید همراه با قارچ بیماری‌زا و همچنین قارچ بیماری‌زا به‌تنهایی مشابه بود و تا 24 ساعت پس از نمونه‌برداری ادامه داشت. همچنین افزایش بیان ژن در تیمار با قارچ بیماری‌زا کمتر از تیمار هم‌زمان سالیسیلیک اسید و قارچ بود (شکل 2- C).

بیان ژن رمزکنندۀ آنزیم کاتالاز در مدت 24 ساعت در هر دو تیمار قارچ و آب مقطر و نیز تیمار هم‌زمان قارچ و سالیسیلیک اسید (2SA+P) افزایش نشان داد (شکل 2-D). در تیمار هم‌زمان SA و بیماری‌زای قارچی در ساعت 12، روند جهشی افزایش دیده شد که در تیمار قارچ بدون سالیسیلیک اسید مشاهده نشد. پس ‌از آن در ساعت 24، تیمار با قارچ افزایش سریع داشت؛ اما تیمار هم‌زمان سالیسیلیک اسید و قارچ، این افزایش را نشان نداد (شکل2-D).

 

   
   

شکل 2- تاثیر سالیسیلیک اسید و قارچ بیماری‌زا بر بیان ژن آنزیم‌های A) فنیل‌آلانین آمونیالیاز (PAL)، B) پراکسیداز (POX)، C) پلی‌فنل اکسیداز (PPO) و D) کاتالاز (CAT) در گندم. SA: سالسیلیک اسید ،P: بیماری‌زا. مقادیر میانگین چهار تکرار و بر اساس آزمون چند‌متغیرة دانکن در سطح (P≤0.01) معنی‌دار هستند.


 

بحث.

نتایج آزمایش مربوط به بیان ژن رمزکنندۀ آنزیم فنیل‌آلانین آمونیالیاز (PAL) در گیاه گندم که با سالیسیلیک اسید تیمار شده بود، نشان داد که 24 ساعت پس از تلقیح قارچ بیماری‌زا، بیان این ژن در هر دو تیمار افزایش داشت و سالیسیلیک اسید هم تأثیر معنی‌داری در افزایش بیان ژن این آنزیم داشت. با توجه به شکل (1)، در گیاهان تیمار‌شده با قارچ و سالسیلیک اسید، افزایش بیان این ژن مشاهده می‌شود و شیب این افزایش از ساعت 12 تا 24 بیشتر شده است. ترکیبات فنیل پروپانوئیدی از سینامیک اسید مشتق می‌شوند و خود سینامیک اسید از آمینو اسید فنیل‌آلانین تشکیل شده است (Huang et al., 2010). آنزیم فنیل‌آلانین آمونیالیاز (PAL)، واکنش تبدیل فنیل‌آلانین را به ترانس سینامیک اسید کاتالیز می‌کند. این مرحله، نخستین قدم در مسیر فنیل پروپانوتید است و گلوگاه تنظیمی مهم بین متابولیسم اولیه و ثانویه به شمار می‌رود (Vogt, 2010; Huang et al., 2010). ترانس _ سینامیک اسید، پیش‌مادۀ طیف گسترده‌ای از متابولیت‌های فنلی و دیگر ترکیبات است. فعالیت آنزیم PAL با عوامل زنده و غیرزندة مختلف القا می‌شود که در نتیجه تجمع ترکیبات فنلی مانند اسیدهای فنلی و فلاونوئیدها را موجب می‌شود. آنزیم PAL با تنظیم متابولیسم ترکیبات مختلف فنلی مقاومت گیاهان نسبت به تنش‌ها را سبب می‌شود (Wen et al., 2005). در آلودگی گندم با قارچ Fusarium graminearum، افزایش بیان ژن PAL در رقم حساس فلات، 3 برابر گزارش شده است که تیمار هم‌زمان سالیسیلیک اسید، این افزایش را به 7 برابر نسبت به گیاه شاهد تلقیح‌شده با آب مقطر رساند. افزایش فعالیت آنزیم فنیل‌آلانین‌آمونیالیاز به‌دنبال افزایش بیان ژن آن مشاهده شد. در پژوهش حاضر، افزایش بیان ژن و فعالیت آنزیم PAL در واریتة متحمل، پس از آلودگی با قارچ، مشاهده شد و تیمار سالیسیلیک اسید آن را تشدید کرد (Sorahinobar et al, 2015). افزایش بیان ژن PALدر گیاه توتون 10 ساعت پس از آلودگی با Pseudomonas syringae گزارش شده است که این افزایش بیان با افزایش فعالیت این آنزیم نیز همراه بوده است (Denslow et al., 2005). همچنین، در برگ‌های گندم آلوده شده با Botrytis cinerea، در محل آلودگی با این قارچ بیماری‌زا، افزایش فعالیت آنزیم PAL مشاهده شده است (Huang et al., 2010).

آنزیم پلی‌فنل اکسیداز در اکسیداسیون فنل به ترکیبات کینون و تشکیل لیگنین نقش دارد. پژوهش‌ها نشان داده است که آنزیم‌هایی مانند پلی‌فنل اکسیداز و فنیل‌آلانین آمونیالیاز در فعالیت‌های دفاعی و واکنش‌های فوق حساس در مقابل قارچ‌های بیماری‌زای گیاهی نقش دارند. این آنزیم همچنین مسئول واکنش‌های قهوه‌ای شدن بافت‌های زخمی و تشکیل سدهای دفاعی در مقابل بیماری‌زاها است. از سویی ترکیبات کینون حاصل از اکسیداسیون فنل‌ها، ترکیباتی به مراتب سمی‌تر از فنل‌ها هستند و نقش آن‌ها در دفاع از گیاه در برابر عوامل بیماری‌زا در گیاهان کاملاً شناخته شده است (Mohammadi and Kazemi, 2002). نتایج مربوط به بیان ژن‌های رمز‌کنندة پلی‌فنل‌اکسیداز (شکل 2-B) در گیاه گندم شاهد و آلوده با قارچ بیماری‌زای القا شده با سالیسیلیک اسید نشان داد که این القا‌کننده، بیان ژن‌های یاد‌شده را در گیاه گندم در حضور و غیاب قارچ بیماری‌زا افزایش داد. اندازه‌گیری آنزیم پلی‌فنل اکسیداز در برهم‌کنش گیاه گندم با قارچ Alternaria triticina مشخص کرد که گرچه فعالیت این آنزیم در رقم متحمل قبل از رویارویی با قارچ، بیشتر از رقم حساس است، تلقیح قارچ بیماری‌زا افزایش فعالیت در هر دو رقم را موجب می‌شود (Tyagi et al., 2000). تشدید فعالیت پلی‌فنل اکسیداز در جو دوسر بر اثر آلودگی باFusarium avenaceumنیز گزارش شده است(Fuerst et al., (2014.

پراکسیداز و کاتالاز آنزیم‌های آنتی‌اکسیدانی هستند که غلظت H2O2 را تنظیم می‌کنند (Chandra et al., 2007). گیاهان برای از‌بین‌بردن اثر رادیکال‌های آزاد ناشی از تنش‌های زنده و غیرزنده، ساز‌‌و‌کارهای دفاعی خود را به کار می‌گیرند. نقش چندین آنزیم از جمله پراکسیداز، کاتالاز، سوپراکساید دیسموتاز، پلی‌فنل اکسیداز و ترکیباتی شبیه به فنل از انواع متابولیت‌های ثانویه که در پاسخ به تنش در گیاهان تجمع می‌یابند به اثبات رسیده است (Honty et al., 2005). بیان این دو آنزیم در گندم‌های آلوده به قارچ بیماری‌زا در غیاب و حضور سالیسیلیک اسید در زمان‌های نمونه‌برداری افزایش یافت (شکل2- C,D). در پاتوسیستم بیماری زنگ برگی (قهوه‌ای) گندم، افزایش بیان ژن آنزیم‌های اکسیداتیو بر اثر قارچ بیماری‌زا گزارش شده است (Fofana et al, 2007). در برهم‌کنش گندم با قارچ بیماری‌زای
Blumeria graminisافزایش فعالیت آنزیم‌های اکسیداتیو 48 ساعت پس از آلودگی در گیاه متحمل نسبت به گیاه حساس مشاهده شد (Ma et al., 2015).

داده‌ها دربارة نقش سالیسیلیک اسید بر فعالیت آنزیم کاتالاز متناقض هستند. خیساندن دانه‌های ذرت در 1/0 میلی‌مولار SA فعالیت آنزیم‌های کاتالاز و پراکسیداز را افزایش داد (Momeni et al., 2012). پیش‌تیمار گیاه شاهی با غلظت 05/0 میلی‌مولار SA به کاهش فعالیت آنزیم کاتالاز منجر شد؛ اما با افزایش غلظت به 1/0 میلی‌مولار، فعالیت این آنزیم افزایش یافت. اگر چه در هر دو غلظت، فعالیت آنزیم نسبت به گیاه شاهد کمتر بود (Hashemi et al., 2010). گزارش شده است که پیش‌تیمار با SA 2/0 میلی‌مولار فعالیت آنزیم کاتالاز را در گیاه عدس پس از 7 روز تنش شوری کاهش داد (Kayednezami and Balouchi, 2013). پاشیدن SA 1 میلی‌مولار در گیاه بادرنجبویة تیمارشده با اشعة فرابنفش به افزایش فعالیت آنزیم پراکسیداز و کاهش فعالیت آنزیم کاتالاز منجر شد (Pourakbar and Adedzadeh, 2014). به نظر می‌رسد غلظت SA استفاده شده و همچنین زمان برداشت نمونه در این تناقض دخیل باشند. در تحقیق حاضر سالیسیک اسید در غلظت 2 میلی‌مولار، افزایش شدید بیان ژن کاتالاز را نسبت به نمونة تلقیح شده با قارچ در مدت 12 ساعت پس از اعمال تیمار به دنبال داشت؛ اما در مدت 24 ساعت پس از اعمال تیمار، این تاثیر را نداشت.

 

جمع‌‌‌‌‌بندی.

براساس نتایج این مطالعه، بیان ژن‌های رمزکنندة هر چهار آنزیم که در این مطالعه بررسی شدند با افزایش ساعات نمونه‌برداری افزایش پیدا کرد. البته این روند افزایشی به‌علت زمان‌های ابتدایی نمونه‌برداری بود (شکل 2). همان‌طور‌که قبلاً هم در بسیاری از تحقیقات به اثبات رسیده است برای این‌که گیاه بتواند در برابر تهاجم عوامل بیماری‌زا مصون بماند باید بیان ژن‌های دفاعی در ساعات ابتدایی پس از تلقیح بیماری‌زا افزایش پیدا کند. در پژوهش حاضر از رقم مقاوم زاگرس استفاده شد لذا افزایش زودهنگام بیان ژن‌ها پدیده‌ای قابل توجیه در ساز‌و‌کار مقاومت گیاه در برابر عامل بیماری‌زا به نظر می‌رسد.

 

سپاسگزاری.

نگارندگان از پژوهشگاه ملی مهندسی ژنتیک و زیست‌فناوری و دانشگاه تربیت مدرس برای فراهم‌کردن امکان این پژوهش سپاسگزاری می‌کنند.


 

منابع

Adhikari, T. B., Balaji, B., Breeden, J. and Goodwin, S. B. (2007) Resistance of wheat to Mycosphaerella graminicola involve early and late peaks of gene expression. Physiological and Molecular Plant Pathology 71: 55-68.

Arraiano, L. S., Chartrain, L., Bossolini, E., Slatter, H. N., Keller, B. and Brown, J. K. M. (2007) A gene in European wheat cultivars for resistance to an African isolate of Mycosphaerella graminicola. Plant Pathology 56: 73-78.

Berraies, S., Gharbi, M. S., Belzile, F., Yahyaoui, A., Hajlaoui, M. R., Trifi, M., Jean, M. and Rezgui, S. (2013) High genetic diversity of Mycospaherella graminicola (Zymoseptoria tritici) from a single wheat field in Tunisia as revealed by SSR markers. African Journal of Biotechnology 12(12): 1344-1349.

Boukef, S., McDonald, B. A., Yahyaoui, A., Rezgui, S. and Brunner, P. C. (2012) Frequency of mutations associated with fungicide resistance and population structure of Mycosphaerella graminicola in Tunisia. European Journal of Plant Pathology 132(1): 111-122.

Brading, P. A., Verstappen, E. C., Kema, G. H. and Brown, J. K. 2002. A gene-for-gene relationship between wheat and Mycosphaerella graminicola, the Septoria tritici Blotch Pathogen. Phytopathology, 92: 439-4.

Chandra, A., Saxena, R., Dubey, A. and Saxena, P. (2007) Change in phenyalalanine ammonia lyase activity and isozyme patterns of poly phenol oxidase and peroxidase by salicylic acid leading to enhanced resistance in cowp ea against Rhizoctonia Solani. Acta Physiologiae Plantarum 29: 361–367.

Chartrain, L., Brading, P., Makepeace, J. and Brown, J. (2004) Sources of resistance to Septoria tritici blotch and implications for wheat breeding. Plant Pathology 53: 454-460.

Denslow, S. A., Walls, A. A. and Daub, M. E. (2005) Regulation of biosynthetic genes and antioxidant properties of vitamin B6 vitamins during plant defense responses. Physiological and Molecular Plant Pathology 66: 244–255.

Esllahi M. R., Safaie, N. and Saidi, A. (2013) Study of resistant gene expression of wheat against to Mycosphaerella graminicola by cDNA - AFLP . PhD thesis, Tarbiat Modares university (in Persian with English abstract).

Fofana, B., Banks, T.W., McCallum, B., Strelkov, S.E. and Cloutier, S. (2007) Temporal gene expression profiling of the wheat leaf rust pathos stem using cDNA microarray reveals differences in compatible and incompatible defiance pathways. International Journal of Plant Genomics 2007: 1-13.

Fuerst, E.P., Okubara, P.A., Anderson, J. V. and Morris C.F. (2014) Poly phenol oxidaseas a biochemical seed defense mechanism. Plant Physiology 5 (689): 1-9.

Gholamnezhad, J., Sanjarian, F., Mohammadi Goltapeh, E., Safaei, N. and Razavi, Kh. (2012) The evaluation of salicylic acid effect on septorios disease by Mycospharella graminicola. Researches Plant Pathology 2(2): 35-46. (in Persian).

Goodwin, S. B., McDonald, B. A. and Kema, G. H. J. (2003) The Mycosphaerella sequencing initiative. In: Global Insights into the Septoria and Stagonospora Diseases of Cereals (Eds. Kema, G. H. J., van Ginkel, M. and Harrabi, M.) 149-151. In: Proceeding of the 6th International Symposium on Septoria and Stagonospora Diseases of Cereals, Tunis, Tunisia. 

Hashemi, Sh., Asrar, Z. and Pourseyedi, Sh. (2010) Effects of seed pretreatment by salicylic acid on growth and some physiological and biochemical parameters in Lepidium sativum. Iranian Journal of Plant Biology 2(2):1-10. (in Persian).

Hayat, Q., Hayat, S., Irfan, M. and Ahmad, A. (2010) Effect of exogenous salicylic acid under changing environment: A review. Environmental and Experimental Botany 68: 14-25.

Honty, K., Hevesi, M., Toth, M. and Stefanovits-Banyai E. (2005) Some biochemical changes in pear fruit tissue induced by Erwinia aymlovora. Acta Biologica Szegediensis 49: 127-129.

Huang, J., Gu, M., Lai, Z., Fan, B., Shi, K., Zhou, Y. H., Yu, J. Q. and Chen, Z. (2010) Functional analysis of the Arabidopsis PALgene family in plant growth, development, and response to environmental stress. Plant Physiology 153:1526–1538.

Kayednezami, R. and Balouchi, H. (2013) Effect of salicylic acid priming on lens cultivars (Lens culinaris Medik.) germination and some physiological traits under salinity conditions. Iranian Journal of Plant Biology 5(18): 15-36. (in Persian).

Kia, S. and Torabi, M. (2008) Effects of infection with septoria leaf blotch (Septoria tritici) at different growth stages on yield and yield components of wheat cultivars in Gorgan. Seed and Plant 24: 237-250 (in Persian).

Lynch, K. M., Zannini, E., Guo, J., Axel, C., Arendt, E. K., Kildea, S. and Coffey, A. (2016) Control of Zymoseptoria tritici cause of septoria tritici blotch of wheat using antifungal Lactobacillus strains. Journal of Applied Microbiology 121: 485-494.

Ma, L. X.,. Zhong, S. F., Liu, N., Chen, W. Q., Liu, T. G., Li, X., Zhang, M., Ren, Z. L., Yang, J. Z. and Luo, P. G. (2015) Gene expression profile and physiological and biochemical characterization of hexaploid wheat inoculated with Blumeria graminis f. sp. Tritici. Physiological and Molecular Plant Pathology 90: 39-48.

McDonald, M.C., McDonald, B.A., Solomon, P.S. (2015) Recent advances in the Zymoseptoria tritici –wheat interaction: insights from pathogenomics. Frontiers in Plant Science 6(102): 1-5.

Mohammadi, M. and Kazemi, H. (2002) Changes in peroxidase and polyphenol oxidase activities in susceptible and resistant wheat heads inoculated with Fusarium graminearum and induced resistance. Plant Science 162: 491-498.

Momeni, N., Arvin, M., Khagoei nejad, Gh., Daneshmand, F. and Keramat, B. (2012) The effect of sodium chloride and salicylic acid on antioxidant defense system in maize (Zea mays L.). Journal of Plant Biology 4(14): 23-34. (in Persian).

Pourakbar, L. and Abedzadeh, M. (2014) Effects of UV-B and UV-C radiation on antioxidative enzymes activity of Melissa officinalis and influences of salicylic acid in UV-stress ameliorations. Iranian Journal of Plant Biology 6(21): 23-34. (in Persian).

Quaedvlieg, W., Kema, G. H. J., Groenewald, J. Z., Verkley, G. J. M., Seifbarghi, S., Razavi, M., Gohari, A. M. and Mehrabi, R. (2011) Zymoseptoria gen. Nov.: A new genus to accommodate Septoria-like species occurring on graminicolous hosts". Persoonia - Molecular Phylogeny and Evolution of Fungi 26: 57–69.

Rabbani, M. A., Maruyama, K., Abe, H., Khan, M. A., Katsura, K., Ito, Y., Yoshiwara, K., Seki, M., Shinozaki, K. and Yamaguchi-Shinozaki, K. (2003) Monitoring expression profiles of rice genes under cold, drought, and high-salinity stresses and abscisic acid application using cDNA microarray and RNA gel-blot analyses. Plant Physiology 133: 1755-1767.

Ray, S., Anderson, J. M., Urmeev, F. I. and Goodwin, S. B. (2003) Rapid induction of a protein disulfide isomerase and defense-related genes in wheat in response to the hemibiotrophic fungal pathogen Mycosphaerella graminicola. Plant Molecular Biology 53: 741-754.

Sorahinobar, M., Niknam, V., Ebrahimzadeh, H., Soltanloo, H., Behmanesh, M. and Tahmasebi nferad, S. (2015) Central Role of Salicylic Acid in Resistance of Wheat Against Fusarium graminearum. Journal of Plant Growth Regulation 35(2): 477–491.

Tyagi, M., Kayastha, A. M. and Sinha, B. (2000). The role of peroxidase and polyphenol oxidase isozymes in wheat resistwnce to Alternaria triticina. Biologia Plantarum 43(40): 559-562.

Vakili Bastam, S., Ramezanpour, S. S., Soltanloo, H., Kia, S., Kalatearabi, M. and Pahlavani, M. H. (2010) Inheritance of resistance to septoria tritici blotch (STB) in some Iranian genotypes of wheat (Triticum aestivum L.). International Journal of Genetics and Molecular Biology 2(3): 034-042.

Vogt, T. (2010) Phenylpropanoid biosynthesis. Molecular Plant 3: 2-20.

Wang, X., Tang, C., Zhang, G., Li, Y., Wang, C., Liu, B. Z., Zhao, J., Han, Q. and Huang, L. (2009) cDNA-AFLP analysis reveals differential gene expression in compatible interaction of wheat challenged with Puccinia striifonnis f. sp. tritici. BMC Genomics 10: 289-304.

Wen, P., Chen, J. Y., Kong, W. F., Pan, Q. H., Wan, S. B. and Huang, W. D. (2005) Salicylic acid induced the expression of Phenylalanine ammonia-lyase gene in grape berry. Plant Science 169: 928-934.

Zamani, E., Sanjarian, F., Mohammadi-Goltapeh, E. and Safaie, N. (2016) Studying the resistance of wheat seedlings grown from treated seeds with salicylic acid against Mycosphaerella graminicola. Plant Protection 39(1): 1-14. (in Persian).

Adhikari, T. B., Balaji, B., Breeden, J. and Goodwin, S. B. (2007) Resistance of wheat to Mycosphaerella graminicola involve early and late peaks of gene expression. Physiological and Molecular Plant Pathology 71: 55-68.

Arraiano, L. S., Chartrain, L., Bossolini, E., Slatter, H. N., Keller, B. and Brown, J. K. M. (2007) A gene in European wheat cultivars for resistance to an African isolate of Mycosphaerella graminicola. Plant Pathology 56: 73-78.

Berraies, S., Gharbi, M. S., Belzile, F., Yahyaoui, A., Hajlaoui, M. R., Trifi, M., Jean, M. and Rezgui, S. (2013) High genetic diversity of Mycospaherella graminicola (Zymoseptoria tritici) from a single wheat field in Tunisia as revealed by SSR markers. African Journal of Biotechnology 12(12): 1344-1349.

Boukef, S., McDonald, B. A., Yahyaoui, A., Rezgui, S. and Brunner, P. C. (2012) Frequency of mutations associated with fungicide resistance and population structure of Mycosphaerella graminicola in Tunisia. European Journal of Plant Pathology 132(1): 111-122.

Brading, P. A., Verstappen, E. C., Kema, G. H. and Brown, J. K. 2002. A gene-for-gene relationship between wheat and Mycosphaerella graminicola, the Septoria tritici Blotch Pathogen. Phytopathology, 92: 439-4.

Chandra, A., Saxena, R., Dubey, A. and Saxena, P. (2007) Change in phenyalalanine ammonia lyase activity and isozyme patterns of poly phenol oxidase and peroxidase by salicylic acid leading to enhanced resistance in cowp ea against Rhizoctonia Solani. Acta Physiologiae Plantarum 29: 361–367.

Chartrain, L., Brading, P., Makepeace, J. and Brown, J. (2004) Sources of resistance to Septoria tritici blotch and implications for wheat breeding. Plant Pathology 53: 454-460.

Denslow, S. A., Walls, A. A. and Daub, M. E. (2005) Regulation of biosynthetic genes and antioxidant properties of vitamin B6 vitamins during plant defense responses. Physiological and Molecular Plant Pathology 66: 244–255.

Esllahi M. R., Safaie, N. and Saidi, A. (2013) Study of resistant gene expression of wheat against to Mycosphaerella graminicola by cDNA - AFLP . PhD thesis, Tarbiat Modares university (in Persian with English abstract).

Fofana, B., Banks, T.W., McCallum, B., Strelkov, S.E. and Cloutier, S. (2007) Temporal gene expression profiling of the wheat leaf rust pathos stem using cDNA microarray reveals differences in compatible and incompatible defiance pathways. International Journal of Plant Genomics 2007: 1-13.

Fuerst, E.P., Okubara, P.A., Anderson, J. V. and Morris C.F. (2014) Poly phenol oxidaseas a biochemical seed defense mechanism. Plant Physiology 5 (689): 1-9.

Gholamnezhad, J., Sanjarian, F., Mohammadi Goltapeh, E., Safaei, N. and Razavi, Kh. (2012) The evaluation of salicylic acid effect on septorios disease by Mycospharella graminicola. Researches Plant Pathology 2(2): 35-46. (in Persian).

Goodwin, S. B., McDonald, B. A. and Kema, G. H. J. (2003) The Mycosphaerella sequencing initiative. In: Global Insights into the Septoria and Stagonospora Diseases of Cereals (Eds. Kema, G. H. J., van Ginkel, M. and Harrabi, M.) 149-151. In: Proceeding of the 6th International Symposium on Septoria and Stagonospora Diseases of Cereals, Tunis, Tunisia. 

Hashemi, Sh., Asrar, Z. and Pourseyedi, Sh. (2010) Effects of seed pretreatment by salicylic acid on growth and some physiological and biochemical parameters in Lepidium sativum. Iranian Journal of Plant Biology 2(2):1-10. (in Persian).

Hayat, Q., Hayat, S., Irfan, M. and Ahmad, A. (2010) Effect of exogenous salicylic acid under changing environment: A review. Environmental and Experimental Botany 68: 14-25.

Honty, K., Hevesi, M., Toth, M. and Stefanovits-Banyai E. (2005) Some biochemical changes in pear fruit tissue induced by Erwinia aymlovora. Acta Biologica Szegediensis 49: 127-129.

Huang, J., Gu, M., Lai, Z., Fan, B., Shi, K., Zhou, Y. H., Yu, J. Q. and Chen, Z. (2010) Functional analysis of the Arabidopsis PALgene family in plant growth, development, and response to environmental stress. Plant Physiology 153:1526–1538.

Kayednezami, R. and Balouchi, H. (2013) Effect of salicylic acid priming on lens cultivars (Lens culinaris Medik.) germination and some physiological traits under salinity conditions. Iranian Journal of Plant Biology 5(18): 15-36. (in Persian).

Kia, S. and Torabi, M. (2008) Effects of infection with septoria leaf blotch (Septoria tritici) at different growth stages on yield and yield components of wheat cultivars in Gorgan. Seed and Plant 24: 237-250 (in Persian).

Lynch, K. M., Zannini, E., Guo, J., Axel, C., Arendt, E. K., Kildea, S. and Coffey, A. (2016) Control of Zymoseptoria tritici cause of septoria tritici blotch of wheat using antifungal Lactobacillus strains. Journal of Applied Microbiology 121: 485-494.

Ma, L. X.,. Zhong, S. F., Liu, N., Chen, W. Q., Liu, T. G., Li, X., Zhang, M., Ren, Z. L., Yang, J. Z. and Luo, P. G. (2015) Gene expression profile and physiological and biochemical characterization of hexaploid wheat inoculated with Blumeria graminis f. sp. Tritici. Physiological and Molecular Plant Pathology 90: 39-48.

McDonald, M.C., McDonald, B.A., Solomon, P.S. (2015) Recent advances in the Zymoseptoria tritici –wheat interaction: insights from pathogenomics. Frontiers in Plant Science 6(102): 1-5.

Mohammadi, M. and Kazemi, H. (2002) Changes in peroxidase and polyphenol oxidase activities in susceptible and resistant wheat heads inoculated with Fusarium graminearum and induced resistance. Plant Science 162: 491-498.

Momeni, N., Arvin, M., Khagoei nejad, Gh., Daneshmand, F. and Keramat, B. (2012) The effect of sodium chloride and salicylic acid on antioxidant defense system in maize (Zea mays L.). Journal of Plant Biology 4(14): 23-34. (in Persian).

Pourakbar, L. and Abedzadeh, M. (2014) Effects of UV-B and UV-C radiation on antioxidative enzymes activity of Melissa officinalis and influences of salicylic acid in UV-stress ameliorations. Iranian Journal of Plant Biology 6(21): 23-34. (in Persian).

Quaedvlieg, W., Kema, G. H. J., Groenewald, J. Z., Verkley, G. J. M., Seifbarghi, S., Razavi, M., Gohari, A. M. and Mehrabi, R. (2011) Zymoseptoria gen. Nov.: A new genus to accommodate Septoria-like species occurring on graminicolous hosts". Persoonia - Molecular Phylogeny and Evolution of Fungi 26: 57–69.

Rabbani, M. A., Maruyama, K., Abe, H., Khan, M. A., Katsura, K., Ito, Y., Yoshiwara, K., Seki, M., Shinozaki, K. and Yamaguchi-Shinozaki, K. (2003) Monitoring expression profiles of rice genes under cold, drought, and high-salinity stresses and abscisic acid application using cDNA microarray and RNA gel-blot analyses. Plant Physiology 133: 1755-1767.

Ray, S., Anderson, J. M., Urmeev, F. I. and Goodwin, S. B. (2003) Rapid induction of a protein disulfide isomerase and defense-related genes in wheat in response to the hemibiotrophic fungal pathogen Mycosphaerella graminicola. Plant Molecular Biology 53: 741-754.

Sorahinobar, M., Niknam, V., Ebrahimzadeh, H., Soltanloo, H., Behmanesh, M. and Tahmasebi nferad, S. (2015) Central Role of Salicylic Acid in Resistance of Wheat Against Fusarium graminearum. Journal of Plant Growth Regulation 35(2): 477–491.

Tyagi, M., Kayastha, A. M. and Sinha, B. (2000). The role of peroxidase and polyphenol oxidase isozymes in wheat resistwnce to Alternaria triticina. Biologia Plantarum 43(40): 559-562.

Vakili Bastam, S., Ramezanpour, S. S., Soltanloo, H., Kia, S., Kalatearabi, M. and Pahlavani, M. H. (2010) Inheritance of resistance to septoria tritici blotch (STB) in some Iranian genotypes of wheat (Triticum aestivum L.). International Journal of Genetics and Molecular Biology 2(3): 034-042.

Vogt, T. (2010) Phenylpropanoid biosynthesis. Molecular Plant 3: 2-20.

Wang, X., Tang, C., Zhang, G., Li, Y., Wang, C., Liu, B. Z., Zhao, J., Han, Q. and Huang, L. (2009) cDNA-AFLP analysis reveals differential gene expression in compatible interaction of wheat challenged with Puccinia striifonnis f. sp. tritici. BMC Genomics 10: 289-304.

Wen, P., Chen, J. Y., Kong, W. F., Pan, Q. H., Wan, S. B. and Huang, W. D. (2005) Salicylic acid induced the expression of Phenylalanine ammonia-lyase gene in grape berry. Plant Science 169: 928-934.

Zamani, E., Sanjarian, F., Mohammadi-Goltapeh, E. and Safaie, N. (2016) Studying the resistance of wheat seedlings grown from treated seeds with salicylic acid against Mycosphaerella graminicola. Plant Protection 39(1): 1-14. (in Persian).