بررسی میزان بیان ژن‌های خانوادة CBL، در تنش خشکی و حملة ویروس در دو رقم حساس و مقاوم به خشکی گوجه‌فرنگی با روش PCR نیمه‌کمّی

نوع مقاله: مقاله پژوهشی

نویسندگان

1 گروه زیست شناسی، دانشگاه پیام نور، صندوق پستی 3697-19395 تهران، ایران

2 گروه بیوتکنولوژی، دانشگاه پیام نور، تهران، ایران

3 گروه سلولی و مولکولی، دانشکده شیمی، دانشگاه کاشان، صندوق پستی 53153-87317 کاشان، ایران

چکیده

کلسیم، یک جزء حیاتی مهم برای شماری از مسیر‌های انتقال پیام در گیاهان است که به واسطه انواعی از گیرنده‌های اختصاصی از جمله پروتئین‌های شبه‌کلسی‌نورین B (CBL) در درک تنش‌های محیطی، عمل می‌کند. در پژوهش حاضر، با رویکردهای بیوانفورماتیک، 11 ژن رمزکنندة پروتئین‌های شبه‌کلسی‌نورین B با درجة حفاظت‌شدگی زیاد در گیاه گوجه‌فرنگی شناسایی و تأیید شد. با بهره‌گیری از یک روش مبتنی بر ارتوژنی، این پروتئین‌ها به 5 کلاس مجزای SlCBL1، SlCBL3، SlCBL4، SlCBL8 و SlCBL10 تقسیم‌بندی و نام‌گذاری شدند. تحلیل توالی‌های پروتئینی نشان داد که همة اعضای CBLهای 1 و 4 که شامل 5 پروتئین می‌شوند، یک ناحیة حفاظت‌شدة مریستویلاسیون در بخش N-ترمینال دارند. بررسی با روش PCR نیمه‌کمّی نشان داد که میان CBLهای کلاس 1، بیان ژن SlCBL1-3 در هردو تنش خشکی، حملة ویروس و ترکیب این دو، تنها در رقم حساس افزایش داشته است. دربارة CBLهای کلاس 3، اگرچه دو ژن SlCBL3-1 و SlCBL3-2 در تنش خشکی در هردو رقم حساس و مقاوم، افزایش بیان نشان دادند، اعمال هم‌زمان دو تنش، اثر افزایشی بر بیان این ژن‌ها نداشت. بین دو همولوگ کلاس 4 نیز، تنها SlCBL4-1 در هردو تنش خشکی و ویروس افزایش بیان نشان داد. براساس نتایج، رفتار بیانی ژن‌های کلاسSlCBL8 در شرایط مختلف تنش و ارقام مختلف، متنوع بود. بیان تنها ژن موجود در کلاس SlCBL10 نیز در رقم حساس با هیچ‌کدام از تنش‌های یاد‌شده افزایش نیافت و تنها در رقم مقاوم، در تنش خشکی افزایش بیان داشت. به‌طورکلی، استنباط شد که با تغییر الگوی بیان ژن‌های CBL در هردو تنش زیستی و غیرزیستی، احتمالاً مسیر‌های پیام‌رسانی CBL/CIPK متفاوتی در گیاهان حساس و مقاوم فعال می‌شوند.

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Evaluation of the CBL family gene expression under drought stress and virus attack in two susceptible and drought tolerant tomato cultivars using semi-quantitative PCR analysis

نویسندگان [English]

  • Peyman Aghaie 1
  • Mohammad Ali Ebrahimi 2
  • Sayed Ali Hosseini Tafreshi 3
  • Maryam Haerinasab 1
  • Shekoofeh Enteshari 1
1 Department of Biology, Faculty of Science, Payame Noor Universtiy, PO BOX 19395-3697 Tehran, Iran
2 Department of Biotechnology, Payame Noor, University, Tehran, Iran
3 Department of cell and molecular biology, Faculty of chemistry, University of Kashan, PO BOX 8731753153, Kashan, Iran
چکیده [English]

Eleven genes encoding Calcineurin B-Like proteins with a high degree of sequence conservation were identified using bioinformatics approaches in tomato. These proteins classified into five clusters including SlCBL1, SlCBL3, SlCBL4, SlCBL8 and SlCBL10 using orthology-based method of nomenclature. Sequence analysis showed that all five members of SlCBL1 and SlCBL4 contained a myristoylation conserved motif (MGXXXS/T) at their N-terminals. Semi-quantitative RT-PCR showed that among the SlCBL1 members, SlCBL1-3 up-regulated under both drought and virus stresses, as well as the combined treatment. Although, both SlCBL3-1 and SlCBL3-2 up-regulated under both drought and virus stresses in both susceptive and resistant cultivars, the combined stress did not have any additional effect on the expression. Among SlCBL4 members, only SlCBL4-1 up-regulated under drought or virus attack. There was a diverse pattern of expression between the two SlCBL8 members under different stresses in both cultivars. SlCBL10 showed no change in expression pattern under drought or virus stresses in susceptive cultivar and this gene showed to be up-regulated under drought in resistant cultivar. Overall, it was concluded that changes in the expression pattern of CBL genes under biotic and abiotic stresses seemingly induced various CBL/CIPK patways in suseptive or resistant plants.

کلیدواژه‌ها [English]

  • Calcineurin B-Like proteins
  • Calcium
  • Drought stress
  • Gene expression
  • Tomato
  • Virus attack

گیاهان به‌دلیل ناتوانی در جابه‌جایی، به کسب توانایی‌های ویژه دربرابر تنش‌های محیطی مختلف نیاز دارند. این موجودات باید بتوانند پیام‌های مختلف محیطی را دریافت، احساس و درک کنند و متناسب با آن پاسخ دهند. از پرسش‌های اساسی در گرایش‌هایی مانند فیزیولوژی و اکوفیزیولوژی گیاهی این است که گیاهان چگونه پیام‌های مرتبط با شرایط تنش را درک و خود را با آن سازگار می‌کنند (Reddy et al., 2011). به‌طور‌کلی، تنش‌های مختلف محیطی بروز تغییراتی مهم را در سطح بیان بسیاری از ژن‌ها در گیاهان سبب می‌شوند و چنین تغییراتی به تجمع یا کاهش متابولیت‌های ویژه، تغییراتی در رفتار آنزیم‌ها و میزان سنتز پروتئین‌ها و ایجاد پروتئین‌هایی جدید منجر می‌شود (Zhu, 2016).

نقطة آغاز هرگونه سازگاری گیاه در برابر تنش، درک محرک‌های محیطی با سازوکارهای مختلف است. در این میان، سازوکارهای مرتبط با مسیرهای پیام‌رسانی وابسته به کلسیم، اهمیت ویژه‌ای دارند. نقش غلظت و الگوی توزیع کلسیم داخل سلول در انتقال پیام‌های تنشی در گیاهان به‌خوبی اثبات شده است (Pandey et al., 2015). بررسی‌ها نشان داده‌اند که طیفی از محرک‌ها ازجمله خشکی، شوری، دمای زیاد، نور شدید، هورمون‌ها، پاتوژن‌ها و عوامل گره‌زایی، تغییراتی در سطح کلسیم سیتوزولی القا کرده‌اند (Monihan, 2011). در این میان، کالمودولین‌ها (Calmodulin)، پروتئین‌کینازهای وابسته به کلسیم (Calcium-dependent protein kinase) و پروتئین‌های شبه‌کلسی‌نورین B (Calcineurin B-Like (proteins، اصلی‌ترین گیرنده‌های کلسیمی در سلول‌های گیاهی هستند که نقش مهمی در انتقال پیام‌های مرتبط با کلسیم دارند (Shao et al., 2008).

پژوهش‌هایی که به‌تازگی بر هردو مجموعة جانوری و گیاهی انجام شده‌اند، نشان دادند که پیام‌ کلسیم، نه‌تنها با غلظت درون‌سلولی یونCa2+، بلکه با ویژگی‌های مکانی و زمانی آن در سلول نیز بیان می‌شود و اغلب بسته به ماهیت پیام‌‌های خارجی، متفاوت است (Rudd and Franklin‐Tong, 2001)؛ بنابراین هر پیام‌، مجموعة متمایزی از تغییرات Ca2+ ایجاد خواهد کرد که مانند رمز عمل می‌کند. فرایند‌ بازگشایی رمز‌ها، با اتصال متفاوت Ca2+ به گیرنده‌های اختصاصی دارای میل ترکیبی زیاد آغاز می‌شود. برهم‌کنش میان گیرنده‌ها و عوامل فرودست‌ آنها اغلب عملکرد دیگر پروتئین‌ها ازجمله، عوامل رونویسی یا پروتئین‌های غشایی را تعدیل و تغییراتی در روند فرایند‌های سلولی ازجمله بیان ژن و شارش یون‌ها ایجاد می‌کند.

"پروتئین‌های شبه کلسی‌نورین B" که به اختصار آنها را  CBLمی‌نامند، خانواده‌ای از حسگرهای کلسیمی هستند که به‌سبب شباهت‌ بخشی از ساختارشان با زیرواحد تنظیمی B در کلسی‌نورین فسفاتازهای جانوری به این نام معروف شده‌اند (Kudla et al.,1999؛ (Batistič and Kudla, 2009. این پروتئین‌ها هم از نظر فیزیکی و هم از نظر عملکردی با گروه ویژه‌ای از پروتئین‌ها موسوم به پروتئین‌های کیناز‌ی برهم‌کنش‌کننده با CBL (CBL-Interacting Protein Kinase یا CIPK) تعامل دارند و فعالیت کینازی آنها را تنظیم می‌کنند (Batistic et al., 2011). در آرابیدوپسیس و برنج، حدود 10 نوع CBL شناسایی شده‌اند که به‌ترتیب با 25 و 30 نوع CIPK برهم‌کنش نشان داده‌اند (Kolukisaoglu et al., 2004). از نظر ساختاری، همة CBLها یک هستة مرکزی و نسبتاً حفاظت‌شدة مشترک با حداقل سه ناحیة متصل‌شونده به کلسیم به‌نام EF hand دارند (Batistic and Kudla, 2004). نقش‌های فیزیولوژیک پروتئین‌های CBL و CIPK، نخستین بار در مسیر SOS (Salt Overly (Sensitive در گیاه آرابیدوپسیس کشف و معرفی شد (Qiu et al., 2002). درحال‌حاضر، مشخص شده است که شبکة CIPK-CBL، ارائه‌کنندة سازوکاری متفاوت برای رمزگشایی Ca2+ است که در گیاهان به‌گونه‌ای منحصربه‌فرد عمل می‌کند. در این مسیر، هر CBL با زیرمجموعه‌ای از CIPK‌ها برهم‌کنش دارد و به‌صورت متقابل، هر CIPK با یک یا تعداد بیشتری از CBL‌ها برهم‌کنش نشان می‌دهد. این مسئله ممکن است شاهدی بر وجود عملکرد بسیار اختصاصی و گستردگی کنش این پروتئین‌ها باشد Batistic and Kudla, 2004)؛ (Luan, 2009.

گزارش‌های متعدد، بر نقش CBL‌ها در پاسخ به تنش‌های مختلف زیستی و غیرزیستی تأکید دارند Albrecht et al., 2003)؛ Cheong et al., 2003؛ Drerup et al., 2013). بررسی‌های بیوشیمیایی نشان داده‌اند که میزان بیان CBL1 گیاه آرابیدوپسیس و پیام‌رسانی متأثر از آن، در شرایط تنش‌های غیرزنده مانند زخم، سرما، خشکی و شوری شدید تغییر می‌کنند (Kudla et al., 1999). جالب است که CBL9 این گیاه، باوجود شباهت زیاد از نظر توالی آمینواسیدی با CBL1 می‌تواند در پاره‌ای از جنبه‌های فیزیولوژی گیاهی مانند پاسخ به آبسزیک اسید و بیوسنتز این ماده در جریان جوانه‌زنی دانه‌ها، به‌گونه‌ای متفاوت از CBL1 عمل کند (Pandey et al., 2004). همچنین پژوهش‌های Pandey و همکاران (2015) بر نقش هردو CBL2 و CBL3 آرابیدوپسیس در همراهی با CIPK21 در تنش اسمزی و شوری تأکید دارند. در پژوهش دیگری به نقش CBL10 در مسیر مقاومت به نمک اشاره شده است Kim et al., 2007)؛ (Quan et al., 2007. ازسویی مشخص شده است که مسیر‌های CBL-CIPK در مجموعه‌های انتقال عناصر غذایی، تنظیم‌کنندة هموستازی یون‌های سدیم، پتاسیم، نیترات و پروتون هستند Xu et al., 2006)؛ Ho et al., 2009).

درمجموع، به نظر می‌رسد که شیوه و میزان متفاوت بیان ژن‌های مختلف CBL هنگام رویارویی با تنش‌های مختلف، متناسب با نقش فیزیولوژیک و جهت‌گیری عملکردی پروتئین‌های آن، تغییر کند (Pandey et al., (2015. ازآن‌جاکه تاکنون بررسی جامعی دربارة نقش پروتئین‌های CBL و بیان متفاوت آنها در شرایط تنش زنده و غیرزنده انجام نشده است، در پژوهش حاضر، بیان ژن‌های خانوادة CBL در شرایط تنش خشکی، حملة ویروسی و اعمال هم‌زمان هر‌دو تنش در دو رقم مقاوم و حساس گوجه‌فرنگی یعنی گیاه الگو بررسی و مقایسه شده است. پژوهشگران، این گیاه را به‌علت ارزش اقتصادی مناسب، شناخته‌شده‌بودن ژنوم، سرعت زیاد رشد و امکان تکثیر راحت، الگویی برای درک و مقایسة پاسخ‌های بیان ژن‌ها در گیاهان می‌دانند.

 

 

 

مواد و روش‌ها

تهیة مادة گیاهی: ارقام Cal j و فلات Y گوجه‌فرنگی، پس از انجام یک بررسی مقدماتی و اعمال تیمارهای خشکی و براساس ارزیابی شاخص‌های رشد، بیوشیمیایی و فیزیولوژیک از میان 14 کولتیوار رایج کشت‌شده در مناطق مختلف ایران، به‌ترتیب، رقم حساس و مقاوم انتخاب شدند (نتایج نشان داده نشده‌اند). بذرها پس از گندزدایی با محلول 5/1 درصد سدیم هیپوکلریت (NaOCl) و چند بار آب‌شویی با آب مقطر استریل، برای کشت به سینی‌های نشای حاوی پیت‌ماوس (شرکت Klasmann-Deilmann GmbH، آلمان) منتقل شدند. جوانه‌زنی بذر‌ها و تهیة نشاء در اتاقک رشد با رطوبت نسبی حدود 60 درصد و در دورة نوری 16 ساعت روشنایی و 8 ساعت تاریکی، شدت نور 4000 میکرومول فوتون بر متر مربع بر ثانیه و دمای بین 2 ± 23 درجة سانتی‌گراد انجام شد. نشاهای 6 روزه (مرحلة 2 برگی) با دقت به گلدان‌های 8 سانتی‌متری حاوی پیت‌ماوس منتقل و به‌مدت 4 روز به‌مقدار ظرفیت زراعی آبیاری شدند.

اعمالتنش‌های‌ خشکی و ویروسی بر گیاهچه‌های گوجه‌فرنگی: برای اعمال تیمارهای خشکی، ویروس و تیمار ترکیبی خشکی و ویروس، گیاهچه‌های مرحلة 10 روزه به چهار گروه تقسیم شدند. گروه اول شامل گیاهچه‌های شاهد بودند که در ابتدا با بافر تلقیح بدون ویروس تزریق شده بودند و تا پایان دورة آزمایش به‌مقدار 100 درصد ظرفیت زراعی و به‌‌صورت دو روز در میان با محلول یک‌دهم درصد هوگلند آبیاری شدند. این گروه برای نمونة شاهد هردو تیمار خشکی و ویروس استفاده شدند.

گروه دوم شامل گیاهچه‌هایی بودند که تنها در تنش خشکی قرار گرفتند. 23 روز پس از تلقیح بافر بدون ویروس، اعمال تنش خشکی آغاز شد. به‌این‌ترتیب، این گیاهچه‌ها ابتدا به‌مدت یک هفته با 75 درصد ظرفیت زراعی و در هفته‌های بعدی به‌ترتیب با 50 و 25 درصد ظرفیت زراعی و به‌صورت دو روز در میان با محلول یک‌دهم درصد هوگلند آبیاری شدند.

گروه سوم شامل گیاهچه‌هایی بودند که تنها در تنش زیستی ویروسی قرار گرفتند. بدین‌منظور، بافر تلقیح حاوی ویروس Tobacco Rattle Virus یا TRV که یک ویروس RNA ای دوبخشی است، به گیاهچه‌های 10 روزه تزریق شد؛ سپس آبیاری این گروه از گیاهچه‌ها تا پایان آزمایش به‌صورت دو روز در میان و با 100 درصد ظرفیت زراعی با محلول یک‌دهم درصد هوگلند انجام شد.

گروه چهارم شامل گیاهچه‌هایی بودند که در تنش هم‌زمان خشکی و ویروس قرار گرفتند. 23 روز پس از تلقیح بافر تلقیح حاوی ویروس، تنش خشکی مشابه گروه دوم بر آنها اعمال شد.

آماده‌کردن و تزریق بافر تلقیح ویروس: تهیة بافر تلقیح (Infiltration Buffer) با روش Velásquez و همکاران (2009) انجام شد. برای آلوده‌کردن برگ‌ها، بافر تلقیح حاوی باکتری ناقل پلاسمیدpTRV1  (Tobacco rattle virus) به نسبت یک به یک، با بافر تلقیح حاوی باکتری ناقل پلاسمید pTRV2 مخلوط شد و با یک سرنگ استریل انسولین، در حجمی برابر، به هریک از برگ‌های لپه‌ای گیاهچه‌های 10 روزه تزریق شدند. از بافر بدون ویروس به همین روش، برای تزریق به گروه‌های گیاهی شاهد و تنش خشکی استفاده شد. تنظیم کارایی تلقیح ویروس، با تزریق باکتری ناقل پلاسمید pTRV2 دارای ژن فیتوئن دساچوراز (Phytoene desaturase) انجام شد که خاموش‌شدن این ژن در گیاه و بروز فنوتیپ سفید‌شدگی نوری را باعث شد و تنظیم مثبتی برای کارایی فرایند آلوده‌کردن با ویروس بود.

بررسی ژن‌ها و طراحی آغازگر‌ها: جستجو برای شناسایی هم‌جورهای (Homologs) ژن‌های CBL در گیاه گوجه‌فرنگی، با ابزارهای BLASTt، BLASTp و  tBLASTnدر پایگاه‌های داده‌ای پروتئینی و نوکلئوتیدی NCBI، Uniprot، EMBL-EBI، DDBJ وSolGenomics و از میان انواع داده‌های cDNA، توالی‌های پروتئینی، کانتیگ‌ها، کروموزوم‌ها و CDSها انجام شد. در این جستجوها از CBLهای پیش‌تر شناسایی‌شدة آرابیدوپسیس، در دسترس در پایگاه داده‌ای TAIR (www.Arabidopsis.org)، برای توالی ورودی (Query) به بلاست استفاده شد (Kleist et al., (2014. حد آستانة E-Value در بلاست برای خارج‌کردن توالی‌های CBL غیر‌همولوگ، 4-10 در نظر گرفته شد. حضور موتیف‌های EF-hand در توالی‌های یافت‌شده و درنهایت، تأیید پروتئین‌های CBL با ورود و تحلیل توالی‌ها در دو پایگاه PROSITE (prosite.expasy.org) و SMART (smart.embl.de) انجام شد. نام‌گذاری CBL‌های شناسایی‌شده با روش اورتوژنی، بر پایة میزان مشابهت با CBLهای آرابیدوپسیس و همولوژی‌های درون خانواده انجام و سپس مقایسه و هم‌ردیفی چندگانة توالی ژن‌های مختلف CBL، با روش Motif-based و با نرم‌افزار آنلاین MAFFT (mafft.cbrc.jp) انجام شد.

طراحی آغازگر‌های اختصاصی برای هریک از ژن‌های CBL، از روی توالی‌های شناسایی‌شده و با نرم‌افزار PrimerQuest (https://eu.idtdna.com) انجام شد. به‌دلیل شباهت بسیار زیاد بخش‌های رمزکنندة پروتئین در CBL، آغازگر‌های اختصاصی، بیشتر از نواحی غیرترجمه‌ای mRNA‌‌ی این ژن‌ها طراحی شدند. آغازگر‌های طراحی‌شده، با نرم‌افزار OligoAnalyzer نسخة 1/3 به‌طور کیفی ارزیابی شدند (جدول 1).

 

جدول 1- مشخصات آغازگرهای استفاده‌شده برای ژن‌های CBL گوجه‌فرنگی

نام  CBL

توالی آغازگر رفت (Forward)

دمای اتصال

درصد GC

توالی آغازگر برگشت (Reverse)

دمای اتصال

درصد GC

SlCBL1-1

GCAACGGAGTGATTGGATTTG

62

6/47

AGATAGATGAAGAAGAATGGAAGG

62

5/38

SlCBL1-2

GTCTTCTCTTCTTTCTGCTCTC

8/60

5/45

AGATGAAATTGCTCGTCCTTTA

1/57

4/36

SlCBL1-3

TTTCAGTCTCCCTCAGC

2/57

9/52

AGATGCAAACTTTCAAAGGG

3/56

40

SlCBL3-1

AGCTGCATATAGATAGGTTTCAG

2/59

1/39

ATCAAGATCGCAACACCTC

58

4/47

SlCBL3-2

CTCCTCTCTTCAGACAAATAGC

8/60

5/45

AGACAGAGAGGCACCTAAA

58

4/47

SlCBL4-1

GCTATATCTATGGCTTCTATAGTTTGAC

7/61

7/35

CATCTAACAACCTGCCACAATTA

2/59

1/39

SlCBL4-2

GAATGGTATAGTGCTGCTGAAGA

61

5/43

GGGAAAGCAGCCCATCAA

9/59

6/55

SlCBL8-1

TCCATCCCTACAAACAAT

1/53

9/38

TAAGACTCTAACGCCAAA

1/53

9/38

SlCBL8-2

CTGATATACCATAAACTGTAGTTCG

7/59

36

CAGTTTGTTGGCTCCGT

2/57

9/52

SlCBL10

CTAGCCATAGCGAGGAAATATG

8/60

5/45

TTTAGTAGAAGAAGAGCTGTTGG

2/59

1/39

EF1α

CCAAGAGGCCATCAGACAAA

1/55

50

GTAGAGACTGGCGTAATCAAGC

3/55

50


استخراج RNA و سنتز cDNA: برای استخراج RNA کل، برگ‌های گیاهان دوماهه برداشت و پس از تثبیت سریع در ازت مایع، در فریزر نگهداری شدند. استخراج RNA کل از 50 میلی‌گرم بافت فریز‌شده و با کیت استخراج (مدل HiYield™ Total RNA Mini Kit-Pant، شرکت RBC Bioscience، مالزی) HiYield™ Total RNA Mini Kit (Plant) شرکت RBC Bioscience انجام و کیفیت و کمیت RNA استخراجی با الکتروفورز ژل آگارز و اسپکتروفتومتر ارزیابی شد. قبل از سنتز cDNA و برای حذف DNA ژنومی، RNA استخراج‌شده با آنزیم DNase تیمار شد. سنتز cDNA با 1 میکروگرم از RNA کل، آغازگر Random hexamer و آنزیم ترانس‌کریپتاز معکوس (Thermo Scientific Revert Aid Reverse) انجام شد. در ادامه، مقادیر مساوی cDNA برای انجام واکنش PCR نیمه‌کمّی استفاده شدند.

واکنش زنجیره‌ای پلیمراز نیمه‌کمّی: در پژوهش حاضر، برای بررسی میزان بیان ژن‌های CBL از روش PCR نیمه‌کمّی استفاده شد. از یک جفت آغازگر اختصاصی ژن خانه‌دار EF1α گوجه‌فرنگی برای تنظیم داخلی و نرمال‌کردن نتایج حاصل از PCR استفاده شد. توالی این جفت آغازگر با توالی سایر جفت پرایمرهای طراحی‌شده برای ژن‌های CBL در جدول (1) نشان داده شده است. تعیین چرخة بهینة مرحلة تصاعدی، شرایط PCR و مقدار cDNA لازم، با نمونة cDNA حاصل از گیاه شاهد انجام شد. در ادامه، واکنش‌های زنجیره‌ای پلیمراز برای هریک از CBLها با مقادیر هم‌غلظت cDNA حاصل از گیاهان هر تیمار در دو رقم گیاه حساس و مقاوم گوجه و در سه تکرار با شرایط اختصاصی انجام شد. مقادیر مساوی از محصولات PCR حاصل روی ژل آگارز 1 درصد، الکتروفورز و با دستگاه ژل‌داک (مدل XR+، شرکت Βio-Rad، آمریکا) عکس‌برداری شدند. شدت باندهای حاصل با نرم‌افزارImageJ ، نسخة 1.42q (http://rsb.info.nih.gov/ij/index.html) تعیین و با درنظرگرفتن شدت باندهای حاصل از ژن خانه‌دار EF1α، نرمال‌ شد. در پایان، رسم همة نمودارها با نرم‌افزار GraphPad Prism Software نسخة 6 انجام شد.

 

نتایج.

شناسایی بیوانفورماتیک و نام‌گذاری اعضای خانوادة CBL درگوجه‌فرنگی: شناسایی اعضای خانوادة CBL گوجه‌فرنگی با روش‌های متداول بیوانفورماتیک انجام شد. در بررسی حاضر، نخست کوشش شد تا با تکیه بر اطلاعات موجود در چهار پایگاه اصلی بیوانفورماتیک جهانی (NCBI، Uniprot، EMBL-EBI و DDBJ) و نیز یک پایگاه اختصاصی خانوادة Solanaceae موسوم به SolGenomics، در مدت انجام عملیات بلاست و با انتخاب ژن‌های ده‌گانة CBLهای شناسایی‌شدة آرابیدوپسیس برای توالی ورودی (Kolukisaoglu et al., 2004)، نسبت به شناسایی همة توالی‌های مرتبط اقدام شود. در جستجوی مقدماتی، 51 توالی بررسی‌شدنی و مرتبط، شناسایی شدند. توالی‌های پروتئینی با نرم‌افزار MAFFT (Algorithm G-INS-i) هم‌ردیف و به‌صورت چشمی برای حذف توالی‌های کوتاه و مشکوک ویرایش شدند تا شمار توالی‌های منحصر‌به‌فرد به 17 گزینه کاهش یابد. در ادامه با جستجوی توالی‌ها روی کروموزوم‌های متناظر، نسبت به حذف توالی‌های ژنی تکراری اقدام شد و بدین‌ترتیب، تعداد توالی‌های مرتبط با CBL که جایگاه انحصاری روی کروموزوم‌های گوجه داشتند به 12 گزینه کاهش یافت. بین این توالی‌ها، توالی با شناسة Solyc08g054570 مندرج در پایگاه دادة SolGenomics، پس از بررسی تعداد موتیف‌های حفاظت‌شدة EF-hand در توالی، حذف شد و تنها توالی‌ها با حداقل سه ساختار EF-hand پذیرفته شدند. درنهایت، 11 توالی منحصربه‌فرد شناسایی شدند (جدول 2) که طول آنها حدود 213 تا 257 آمینواسید بود. این طول تقریباً با طول سایر پروتئین‌های CBL شناسایی‌شده در دیگر گروه‌های گیاهی، منطبق بود (Zhang et al., 2008). برای نام‌گذاری پروتئین‌های CBL شناخته‌شده در گوجه‌فرنگی، از یک روش نام‌گذاری مبتنی بر ارتوژنی استفاده شد. در این روش، توالی‌های نوکلئوتیدی و پروتئینی CBL گیاه آرابیدوپسیس، ژن‌های ورودی ارتولوگ در نظر گرفته شدند. CBLهای پارالوگ، با اختصاص شماره‌های متفاوت از هم جدا شدند و توالی‌های CBL ارتولوگ نیز با قید شماره‌ای پس از خط فاصله، از هم متمایز شدند (Mohanta et al., 2015). در جدول (2)، شناسه‌های متفاوتی که با روش‌های مختلف نام‌گذاری در پایگاه‌های داده برای CBLها تعیین شده‌اند، با هم مقایسه شده‌اند. مقایسة طول توالی‌های پروتئینی CBLهای گوجه‌فرنگی با جایگاه استقرار موتیف  EF-handآنها در شکل (1) نشان داده شده است.

 

جدول 2- نام‌گذاری متفاوت توالی‌های CBL شناسایی‌شده در ژنوم گوجه‌فرنگی در پایگاه‌های دادة مختلف - برای معرفی بهتر، رمز شناسة توالی‌ها در SolGenomics و Uniprot آورده شده است. حروف a، b، c، d وe  در بالای هر نام به‌معنی به‌کارگیری آن به‌ترتیب در پایگاه‌های SolGenomics، NCBI، EBI، Uniprot و DDBJ هستند.

شماره

نام

CBL

نام توالی در پایگاه‌های داده‌ای مختلف

تعداد

EF-hand

شناسه توالی در SolGene

شناسه توالی در PROSITE

1

SlCBL1-1

CBL 1 a, d

3

Solyc06g060980

K4C6S8

2

SlCBL1-2

CBL 1 a

3

Solyc08g007160

K4CIK3

3

SlCBL1-3

CBL 1 a

3

Solyc08g077770

G5EM33

4

SlCBL3-1

CBL 2 a, b, c, d

3

Solyc07g065820

G5EM34

5

SlCBL3-2

CBL 1 a

3

Solyc12g015870

M1CX58

6

SlCBL3-3

CBL 3 a

3

Solyc02g032310

K4B5H7

7

SlCBL4-1

CBL 4 a

3

Solyc06g051970

K4C5Y3

8

SlCBL4-2

SlSOS3 b, CBL 4 c, SlCBL4-2 e

3

Solyc03g083320

Q4W3B4

9

SlCBL8-1

CBL 7 a

3

Solyc08g036590

K4CK19

10

SlCBL8-2

CBL 4 a, e

3

Solyc12g055920

K4DFS3

11

SlCBL10

--

3

Solyc08g065330

G4XMX1

 

 

بررسی‌های دقیق‌تر این توالی‌ها مشخص کرد که در بخش N-ترمینال همة اعضای CBLهای 1 و 4 که شامل 5 پروتئین می‌شوند، یک ناحیة حفاظت‌شده (MGXXXS/T) وجود دارد که جایگاه مریستویلاسیون (Myristoylation) شناخته می‌شود. بررسی‌ها نشان دادند که این بخش، محلی برای برهم‌کنش‌های پروتئین با پروتئین یا جایگاهی برای اتصال پروتئین به غشاء است (Luan et al., 2002).


 

شکل 1- مقایسه و هم‌ردیفی چندگانة توالی آمینواسیدی‌CBL های گوجه‌فرنگی - بخش‌های با همولوژی یا شباهت زیاد بین اعضای مختلف CBL با رنگ زمینة تیره‌تر و بخش‌های با شباهت کمتر با زمینة روشن‌تر نشان داده شده‌اند. حدود نواحی حفاظت‌شدة EF-handهای سه‌گانه (EF1-EF3)، به‌صورت نقطه‌چین بالای هر ناحیه و جایگاه حفاظت‌شدة مریستویلاسیون CBLهای گروه 1 و 4، در کادر قرمزرنگ مشخص شده است.

 


بررسی بیان نیمه‌کمّی ژن‌های کلاس‌های مختلف CBL در گیاه گوجه‌فرنگی:نخستین کلاس شناسایی‌شدة CBL در گوجه‌فرنگی، SlCBL1 بود که شامل سه عضو SlCBL1-1، SlCBL1-2 و SlCBL1-3 است. این ژن‌ها، بیان‌های نیمه‌کمّی متفاوتی در تیمارهای تنش ‌خشکی، ویروسی و در جریان تنش هم‌زمان خشکی و ویروس از خود نشان دادند. همچنین نتایج بیان‌کنندة وجود تفاوت معنی‌دار در کمیت بیان این ژن‌ها در ارقام حساس و مقاوم به خشکی گوجه‌فرنگی بود (شکل 2). دربارة SlCBL1-1، نشان داده شد که افزایش معنی‌داری در بیان این ژن در هردو تنش خشکی و حملة ویروس و نیز هنگام القای هم‌زمان این دو تنش، در هردو رقم حساس و مقاوم نسبت به گیاهان شاهد به وجود آمده است؛ البته در رقم حساس، نسبت به رقم مقاوم، تنش خشکی اثر القایی بیشتری بر افزایش بیان این ژن داشته است (شکل2-A). بررسی‌ها نشان داد که تفاوت معنی‌داری در بیان ژن SlCBL1-2 در هنگام تنش‌های خشکی، ویروس و تنش هم‌زمان آنها در هردو رقم حساس و مقاوم به خشکی نسبت به تیمارهای شاهد وجود نداشته است (شکل2-B). نتایج همچنین نشان داد که بیان ژن SlCBL1-3 در هر دو تنش خشکی و حملة ویروس و بالطبع در ترکیب این دو تنش، تنها در رقم حساس نسبت به شاهد افزایش داشته است (شکل2-C).

 

 

شکل 2- نمودار بیان نسبی ژن‌های کلاس SlCBL1 در گوجه‌فرنگی در تنش‌های خشکی، حملة ویروسی و ترکیب تنش خشکی و ویروس و مقایسة آن با شاهد (بافر): A (بیان نسبی ژن SlCBL1-1)، B (بیان نسبی ژن (SlCBL1-2 و C (بیان نسبی ژن SlCBL1-3)- شدت باند متناسب با هر نمونه در زیر آن نمایش داده شده است. شدت باند ژن EF1α (ژن خانه‌دار) و تنظیم درونی برای نرمال‌کردن بیان ژن‌های CBL نشان داده شده‌اند. مقادیر، میانگین سه تکرار ± SD است. حروف غیرمشترک، نشان‌دهندة وجود تفاوت معنی‌دار با آزمون دانکن است.


در پژوهش حاضر، به‌دلیل شباهت بسیار زیاد توالی رمزکنندة SlCBL3-3 با نواحی مشابه آن در سایر CBLها و نبود نواحی غیرترجمه‌ای در این ژن، به ساخت آغازگر اختصاصی برای آن موفق نشدیم؛ بنابراین تنها دو عضو از کلاس SlCBL3، شامل SlCBL3-1 و SlCBL3-2 جدا شدند و بیان نیمه‌کمّی آنها بررسی شد. براساس نتایج، شدت باند هردو ژن SlCBL3-1 و SlCBL3-2در تنش خشکی در هر دو رقم حساس و مقاوم، به‌طور معنی‌داری افزایش یافت (شکل‌های 3- A و B). همچنین، اعمال تنش ویروسی به‌تنهایی بیان ژن SlCBL3-1 را در هر دو رقم افزایش داد؛ ولی تغییری در بیان ژن SlCBL3-2 در هیچ‌یک از ارقام حساس و مقاوم گوجه‌فرنگی ایجاد نکرد. در مجموع اعمال هم‌زمان دو تنش (خشکی + ویروس)، تأثیر اضافه‌ای روی بیان ژن‌های این کلاس از CBLها نداشته است.

 

 

شکل 3- نمودار بیان نسبی ژن‌های کلاس SlCBL3 در گوجه‌فرنگی در تنش‌های خشکی، حملة ویروسی و ترکیب خشکی و ویروس و مقایسة آن با شاهد (بافر): A (بیان نسبی ژن SlCBL3-1) و B (بیان نسبی ژن SlCBL3-2)- شدت باند متناسب با هر نمونه در زیر آن نمایش داده شده است. شدت باند ژن EF1α ( ژن خانه‌دار) و تنظیم درونی برای نرمال‌کردن بیان ژن‌های CBL نشان داده شده‌اند. مقادیر، میانگین سه تکرار ± SD است. حروف غیرمشترک، نشان‌دهندة وجود تفاوت معنی‌دار با آزمون دانکن است.


براساس نتایج پژوهش حاضر، رفتار بیانی ژن‌های کلاس SlCBL4 به‌گونه‌ای از یکدیگر متفاوت بوده است؛ درحالی‌که هیچ‌یک از تنش‌های خشکی، حملة ویروسی و ترکیب این دو تنش، بر بیان ژن  SlCBL4-2 در رقم حساس یا مقاوم گوجه تأثیر نداشته است (شکل‌ 4-B). شدت باندهای مربوط به‌ ژن SlCBL4-1 در هردو تنش افزایش یافته است (شکل 4-A)؛ البته در حالت ترکیب این دو تنش، اثر اضافی بر بیان این ژن ملاحظه نشد. مقایسة میانگین داده‌های حاصل از شدت باندها نشان می‌دهد که در رقم حساس، حملة ویروس بیش از تنش خشکی در افزایش بیان ژن SlCBL4-1 مؤثر بوده است. این رفتار در رقم مقاوم گیاه گوجه‌فرنگی مشاهده نشد.

 

 

شکل 4- نمودار بیان نسبی ژن‌های کلاس SICBL4 در گوجه‌فرنگی در تنش‌های خشکی، حملة ویروسی و ترکیب خشکی و ویروس و مقایسة آن با شاهد (بافر): A (بیان نسبی ژن SICBL4-1) و B (بیان نسبی ژن SICBL4-2)- شدت باند متناسب با هر نمونه در زیر آن نمایش داده شده است. شدت باند ژن EF1α (ژن خانه‌دار) و تنظیم درونی برای نرمال‌کردن بیان ژن‌های CBL نشان داده شده‌اند. مقادیر، میانگین سه تکرار ± SD است. حروف غیرمشترک، نشان‌دهندة وجود تفاوت معنی‌دار با آزمون دانکن است.

 

 

نتایج نشان دادند که ژن‌های مربوط به کلاس SlCBL8 نیز رفتار بیانی متمایز و متنوعی در شرایط تنش مختلف و ارقام متفاوت از خود نشان دادند (شکل‌های 5- Aو B). در هر دو رقم حساس و مقاوم، تنش خشکی القای بیان بیشتر هر دو ژن SlCBL8-1 و SlCBL8-2 را باعث شد. همچنین در رقم مقاوم، بیان ژن‌های SlCBL8-1 و SlCBL8-2 هنگام آلوده‌شدن گیاه با ویروس، به‌طور معنی‌داری نسبت به شاهد افزایش یافت؛ ولی در رقم حساس، تنها بیان SlCBL8-1 و نه  SlCBL8-2 نسبت به شاهد، بیشتر و چشمگیر بود.

 

 

شکل 5- نمودار بیان نسبی ژن‌های کلاس SlCBL8 در گوجه‌فرنگی در تنش‌های خشکی، حملة ویروسی و ترکیب خشکی و ویروس و مقایسة آن با شاهد (بافر): A (بیان نسبی ژن SICBL8-1) و B (بیان نسبی ژنSlCBL8-2 )- شدت باند متناسب با هر نمونه در زیر آن نمایش داده شده است. شدت باند ژن EF1α (ژن خانه‌دار) و تنظیم درونی برای نرمال‌کردن بیان ژن‌های CBL نشان داده شده‌اند. مقادیر میانگین سه تکرار ± SD است. حروف غیرمشترک، نشان‌دهندة وجود تفاوت معنی‌دار با آزمون دانکن است.

 


نتایج همچنین نشان دادند که هیچ‌کدام از تنش‌های خشکی، حملة ویروسی و ترکیب این دو، بر بیان تنها ژن CBL موجود در کلاس SlCBL10 در رقم حساس موثر نبوده است و تقریبا با بیان ژن شاهد برابر است (شکل6). همچنین دربارة رقم مقاوم دیده شد که تنها تنش خشکی و نه حملة ویروس (و حتی اثر ترکیبی این دو) افزایش بیان این ژن را نسبت به شاهد باعث شده است.

 

 

شکل 6- نمودار بیان نسبی ژن‌های کلاس SlCBL10 در گوجه‌فرنگی در تنش‌های خشکی، حملة ویروسی و ترکیب خشکی و ویروس و مقایسة آن با شاهد (بافر)- شدت باند متناسب با هر نمونه در زیر آن نمایش داده شده است. شدت باند ژن EF1α (ژن خانه‌دار) و تنظیم درونی برای نرمال‌کردن بیان ژن‌های CBL نشان داده شده‌اند. مقادیر، میانگین سه تکرار ± SD است. حروف غیرمشترک، نشان‌دهندة وجود تفاوت معنی‌دار با آزمون دانکن است.

 


بحث

درج نام و شناسه‌های متفاوت اختصاصی برای توالی‌ها، به‌ویژه توالی‌های CBL در هر پایگاه‌ داده و نبود روشی واحد برای نام‌گذاری با امکان طبقه‌بندی اعضای خانوادة ژنی، موجب شده است، نام‌های متعدد و گیج‌کننده‌ای برای هر توالی انحصاری CBL وجود داشته باشد. این مسئله به بررسی مقدماتی در پژوهش حاضر، و دستیابی به حدود 51 توالی هم‌پوشان منجر شد که در منابع مختلف با نام‌های متفاوتی برای CBLها تعیین شده بودند؛ بنابراین برای دسته‌بندی و یکسان‌کردن بسیاری از این توالی‌های تکراری، از رویکرد بیوانفورماتیک استفاده شد. گزارش‌های قبلی به حضور حداقل 10 یا 11 عضو در خانوادة CBL در گوجه‌فرنگی اشاره کردند Kleist et al., 2014؛ (Mohanta et al., (2015. در بررسی حاضر، کوشش بر این بود تا با پایگاه‌های داده‌ای به‌روز‌شدة ژنومی، در صورت امکان، اعضای جدید CBL در این خانواده شناسایی شوند و پس از حذف توالی‌های غیرمطمئن و تکراری، حضور 11 عضو نهایی برای این خانواده در گوجه‌فرنگی تأیید شد؛ بنابراین براساس داده‌های به‌روز‌شدة ژنومی از سال 2015 تاکنون، امکان افزایش تعداد اعضای این خانوادة پروتئینی وجود نداشت. در پژوهش حاضر، بر وجود
3 ناحیة EF-hand که معیاری برای گزینش پروتئین‌های CBL هستند بسیار تأکید شد و دلیل آن، اهمیت عملکرد هم‌زمان این موتیف‌ها برای انجام درست برهم‌کنش CBL‌ها با CIPKهای شناخته‌شده در گوجه‌فرنگی بود (Kim et al., 2000)؛ همان‌طور‌که اشاره شد، در نام‌گذاری اعضای خانوادة CBL گوجه‌فرنگی، یک روش نام‌گذاری مبتنی بر ارتوژنی به کار‌گرفته شد که پیش‌تر تعدادی از پژوهشگران برای نام‌گذاری برخی خانواده‌های ژنی استفاده کرده بودند (Hamel et al., 2006؛ Mohanta and Mohanta, 2013؛ Mohanta (et al., 2014.در روش مبتنی بر اورتوژنی به کاررفته در پژوهش حاضر، اساس کار بر این اصل استوار بود که شباهت توالی به شباهت ساختاری و متعاقب آن به شباهت عملکردی ژن‌ها منجر می‌شود (Aravind et al., 2002؛ (Schlicker et al., 2006. در این روش، اطلاعات عملکردی یک پروتئین را که به‌صورت تجربی حاصل شده‌اند، به یک پروتئین ناشناختة مشابه تعمیم می‌دهند. چنین روشی پیش‌تر نیز توسط Mohanta و همکاران در سال 2015 برای نام‌گذاری CBL‌های گوجه‌فرنگی و 37 گونه گیاهی دیگر به کار گرفته شد. آنها درنهایت، 5 نوع یا کلاس CBL (1، 3، 4، 8 و 10) که درمجموع، 11 پروتئین را شامل می‌شدند، در این خانواده شناسایی و معرفی کردند. نتیجه‌ای که با پژوهش حاضر، دوباره تأیید شد و بدون تغییر باقی ماند.

الگوی بیان یک ژن در بافتی ویژه و در پاسخ به محرک‌های محیطی موجود، به‌صورت بالقوه، منعکس‌کنندة نقش آن ژن در فرایند‌های تکوینی، فیزیولوژیک و شاید پیام‌رسانی‌های مرتبط با آن بافت است. بررسی‌ها نشان داده‌اند که اعضای یک خانوادة ژنی می‌توانند به‌طور متفاوت از یکدیگر بیان شوند و ازاین‌رو عملکردها و نقش‌های متمایزی نسبت به هم ایفا کنند. در این راستا، بررسی بیان برخی از اعضای خانوادة CBL در آرابیدوپسیس نشان داده است که بیان این ژن‌ها در بافت‌های مختلف یک گیاه، حتی در شرایط مساعد رشدی، متفاوت است (Kudla et al., (1999.

در بررسی حاضر، اعضای مختلف SlCBL1 رفتار‌های کاملاّ متمایزی در تنش‌های خشکی و ویروس و در ارقام مختلف حساس و مقاوم گوجه‌فرنگی از خود نشان دادند. رفتاری که بیش از هر چیز بر اختصاصی‌بودن و بی‌مانندی شیوه‌های عملکردی این ژن‌ها تأکید دارند. پیش‌تر Kudla و همکاران در سال 1999، با بررسی الگوی بیان ایزوفرم‌های 1، 2 و 3 ژن‌های CBL آرابیدوپسیس در تنش‌های خشکی، زخم، سرما، شوک گرمایی و لمس مکانیکی، نشان دادن که تیمارهای زخم، خشکی و سرما تا حد زیادی سطح mRNA ژن AtCBL1 را افزایش می‌دهند. درمقابل، تنش‌های شوک گرمایی و لمس مکانیکی اثری بر بیان این ژن نداشته است. همچنین Albrecht و همکاران (2003)، با ایجاد جهش‌یافته‌های cbl1و اعمال تنش روی آن‌ها، بر نقش CBL1 در تنش‌های خشکی، شوری و سرما تأکید کردند. در برنج، تیمار با پلی‌اتیلن‌گلایکول (PEG) که عامل ایجاد‌کنندة تنش خشکی است، بیان CBL1 را القا کرده است (Gu et (al., 2008. Cheong و همکاران (2003) با مشاهدة افزایش مقاومت به یخ‌زدگی در جهش‌یافته‌های cbl1 به این نتیجه رسیدند که شاید CBL1 یک تنظیم‌کنندة مثبت در تنش‌های شوری و خشکی و یک تنظیم‌کنندة منفی برای سرما در گیاهان است. همچنین پیشنهاد شده است کهCBL1 از مسیر‌های غیروابسته به ABA و CBL9 که شبیه‌ترین عضو به آن است، از مسیر‌های وابسته به ABA و به‌صورت جایگزین، به تنش‌ها پاسخ می‌دهد (D'angelo et al., 2006). هردوی این CBLها در همراهی با CIPK23 در جذب پتاسیم و باز و بسته‌شدن روزنه‌ها هم نقش داشته‌اند (Mao et al., 2016). در کل، نتایج به دست‌آمده نشان از اهمیت بیشتر دو ژن SlCBL1-1 و SlCBL1-3 در هردو تیمار خشکی و حملة ویروسی در گوجه‌فرنگی دارند.

براساس نتایج حاصل از پژوهش حاضر، بیان هردو عضو بررسی‌شدة SlCBL3، در ارقام حساس و مقاوم، در تنش خشکی القا شد. نتیجه‌ای که با برخی گزارش‌های قبلی نیز تأیید شده است (Mahajan et al., 2006). همچنین افزایش بیان این ژن هنگام اعمال تنش زخم، به‌مدت 3 ساعت و تیمار با سالسیلیک اسید که یک حدواسط پاسخ به تنش‌های زیستی است، پس از 8 ساعت گزارش شده است(Mahajan et al., 2006)؛ بنابراین، به نظر می‌رسد که خانوادة پروتئینی CBL3 در پاسخ گیاه به هردو تنش زنده و غیرزنده حائز اهمیت باشد. در تأیید این مطلب، CBL3 یک تنظیم‌کنندة هموستازی درون‌سلولی یون‌ها در تونوپلاست، با برهم‌کنش با H+- ATPase  واکوئلی یاد شده است (Tang et al., 2012). همچنین گزارش شده است که CBL3 در جداکردن و حجره‌بندی Mg2+ در واکوئل و سم‌زدایی از این عنصر نقش دارد (Tang et al., 2015).

در این تحقیق از دو همولوگ SlCBL4 ، تنها بیان SlCBL4-1در هر دو تنش خشکی و ویروس افزایش یافت. این CBL که با نام SOS3 نیز شناخته می‌شود، نخستین عضو از خانواده CBLها در گیاهان است که در مسیر برون شارش Na+، هموستازی و ایجاد مقاومت به تنش نمک از قبل مطرح بوده است (Zhu, 2002). تغییر بیان CBL4 هنگام اعمال تنش‌های خشکی، سرما و شوری در گیاهچه‌های صنوبر، در پژوهش‌های Zhang و همکاران (2008) به اثبات رسیده است. D'angelo و همکاران (2006) نیز معتقدند که این CBL به‌صورت جایگزین با CBL1 در برهم‌کنش با CIPK24 در مسیر پیام‌رسانی تنش شوری عمل می‌کند. یافته‌ها در ذرت نشان داده است که شوری در برگ‌ها به‌صورت کاهشی و در ریشه به‌صورت افزایشی بر بیان SlCBL4 اثرگذار بوده است؛ چنان‌که تیمار با ABA، افزایش و پلی‌اتیلن‌گلایکول، کاهش بیان این ژن را در ذرت باعث شده است (Wang et al., 2007).

بررسی کیفیت بیان CBL8 در دانه‌رست‌های برنج در تیمار با پلی‌اتیلن‌گلایکول، کاهش میزان بیان این ژن را نشان می‌دهد؛ درحالی‌که سرما و تیمار ABA، فزونی بیان این ژن را باعث شده‌اند (Gu et al., 2008). این الگو به‌هیچ‌وجه با داده‌های حاصل از پژوهش حاضر مبنی بر افزایش بیان ژن‌های SlCBL8-1 و SlCBL8-2 در هردو رقم حساس و مقاوم در تنش خشکی منطبق نیست.

در بررسی حاضر، تنش خشکی افزایش بیان CBL10 را در رقم مقاوم باعث شد. این تغییر الگوی بیان CBL10 در تنش‌های غیرزندة دیگر مانند اسمز، شوری و سرما در گیاه صنوبر نیز مشاهده شده است (Zhang et al., 2008). همچنین جهش‌یافته‌های cbl10، فنوتیپ‌های کلروزشدة بدون رشد را هنگام مواجه‌شدن با تنش نمکی از خود نشان داده‌اند (Zhang et al., 2008). در برنج نیز تیمار با پلی‌اتیلن‌گلایکول، افزایش بیان ژن CBL10 را در دانه‌رست‌های در شرایط تنش باعث شده است (Gu et al., 2008). این مدارک، دلیل مستقیمی بر نقش احتمالی این ژن در پاسخ به تنش خشکی است. بیان‌نشدن ژن CBL10 در مواجهه با حملة ویروس، شاید نشان‌دهندة دخالت‌نداشتن این ژن در مسیر پاسخ به تنش‌های ویروسی است.

مشاهدة رفتار‌های پیچیده و متناقض و وجود ایزوفرم‌های چندگانة CBL در گیاهان و ازجمله گوجه‌فرنگی، تا حد زیادی بر پیچیدگی‌های درک چگونگی عملکرد این ژن‌ها افزوده است (Kudla et al., 1999). نتایج حاصل از تحقیق حاضر، به وضوح نشان دادند که مسیر‌های سیگنالی CBL/CIPK در گوجه‌فرنگی در پاسخ به هر دو نوع تنش زیستی و غیرزیستی، رخ می‌دهد. بجز آرابیدوپسیس، برنج و چند گیاه محدود دیگر، مسیرها و پاسخ‌های شبکة CBL/CIPK به تنش‌ در گیاهان عالی چندان بررسی نشده‌اند. شناسایی اعضای این خانوادة ژنی در سایر گیاهان مدل و بررسی مقایسه‌ای ویژگی‌ها، رفتارها و پاسخ‌های صادره در شرایط مختلف زیستی، برای درک بیشتر چگونگی عملکرد شبکه پیام‌رسانی کلسیم اهمیت زیادی دارد (Zhang et al., 2008). درمجموع، به نظر می‌رسد که الگو‌های متنوع بیان ژن‌های CBL به‌نوعی در هماهنگی با نیاز گیاه عمل می‌کنند (Batistic and (Kudla, 2004. در پژوهش حاضر، با بررسی کلی بیان ژن‌های مختلف CBL گوجه‌فرنگی در تنش‌های زیستی (ویروس) و غیرزیستی (خشکی) که با ارائة الگوهای بیانی اختصاصی و هم‌پوشان همراه است، وجود شبکه‌ای پویا و توانمند در پاسخ به نیازهای ناشی از تغییرات محیطی در گیاه استنباط می‌شود. پژوهش‌های بیشتری درزمینة پاسخ CBLهای گیاهی در کنار سایر عوامل مولکولی ازجمله CIPK، عوامل رونویسی و همچنین ژن‌های متأثر از این مسیر در تنش‌های مختلف باید انجام شوند تا درک بهتری از نقش این ژن‌ها در فرایندهای پیام‌رسانی، متابولیک و فیزیولوژی گیاهان حاصل شود.

 

سپاسگزاری

از دانشگاه‌ پیام نور و مرکز تحصیلات تکمیلی دانشگاه کاشان بابت حمایت از اجرای این پژوهش سپاسگزاری می‌شود.

Albrecht, V., Weinl, S., Blazevic, D., D'Angelo, C., Batistic, O., Kolukisaoglu, Ü. and Kudla, J. (2003) The calcium sensor CBL1 integrates plant responses to abiotic stresses. The Plant Journal 36(4): 457-470.

Aravind, L., Mazumder, R., Vasudevan, S. and Koonin, E. V. (2002) Trends in protein evolution inferred from sequence and structure analysis. Current Opinion in Structural Biology 12(3): 392-399.

Batistic, O., Kim, K. N., Kleist, T., Kudla, J. and Luan, S. (2011) The CBL–CIPK network for decoding calcium signals in plants. In: Coding and decoding of calcium signals in plants (Ed. Luan, S.) 235-258. Springer Verlag, Berlin.

Batistic, O. and Kudla, J. (2004) Integration and channeling of calcium signaling through the CBL calcium sensor/CIPK protein kinase network. Planta 219(6): 915-924.

Batistic, O. and Kudla, J. (2009) Plant calcineurin B-like proteins and their interacting protein kinases. Biochimica et Biophysica Acta (BBA) - Molecular Cell Research 1793(6): 985-992.

Cheong, Y. H., Kim, K. N., Pandey, G. K., Gupta, R., Grant, J. J. and Luan, S. (2003) CBL1, a calcium sensor that differentially regulates salt, drought, and cold responses in Arabidopsis. The Plant Cell 15(8): 1833-1845.

D'angelo, C., Weinl, S., Batistic, O., Pandey, G. K., Cheong, Y. H., Schültke, S. and Harter, K. (2006) Alternative complex formation of the Ca2+ regulated protein kinase CIPK1 controls abscisic acid dependent and independent stress responses in Arabidopsis. The Plant Journal 48(6): 857-872.

Drerup, M. M., Schlücking, K., Hashimoto, K., Manishankar, P., Steinhorst, L., Kuchitsu, K. and Kudla, J. (2013) The calcineurin B-like calcium sensors CBL1 and CBL9 together with their interacting protein kinase CIPK26 regulate the Arabidopsis NADPH oxidase RBOHF. Molecular Plant 6(2): 559-569.

Gu, Z., Ma, B., Jiang, Y., Chen, Z., Su, X. and Zhang, H. (2008) Expression analysis of the calcineurin B-like gene family in rice (Oryza sativa L.) under environmental stresses. Gene 415(1): 1-12.

Hamel, L. P., Nicole, M. C., Sritubtim, S., Morency, M. J., Ellis, M., Ehlting, J. and Lee, J. (2006) Ancient signals: comparative genomics of plant MAPK and MAPKK gene families. Trends in Plant Science 11(4): 192-198.

Ho, C. H., Lin, S. H., Hu, H. C. and Tsay, Y. F. (2009) CHL1 functions as a nitrate sensor in plants. Cell 138(6): 1184-1194.

Kim, B. G., Waadt, R., Cheong, Y. H., Pandey, G. K., Dominguez‐Solis, J. R., Schültke, S. and Luan, S. (2007) The calcium sensor CBL10 mediates salt tolerance by regulating ion homeostasis in Arabidopsis. The Plant Journal 52(3): 473-484.

Kim, K. N., Cheong, Y. H., Gupta, R. and Luan, S. (2000) Interaction specificity of Arabidopsis calcineurin B-like calcium sensors and their target kinases. Plant physiology 124(4): 1844-1853.

Kleist, T. J., Spencley, A. L. and Luan, S. (2014) Comparative phylogenomics of the CBL-CIPK calcium-decoding network in the moss Physcomitrella, Arabidopsis, and other green lineages. Frontiers in Plant Science 5: 187.

Kolukisaoglu, Ü., Weinl, S., Blazevic, D., Batistic, O. and Kudla, J. (2004) Calcium sensors and their interacting protein kinases: genomics of the Arabidopsis and rice CBL-CIPK signaling networks. Plant Physiology 134(1): 43-58.

Kudla, J., Xu, Q., Harter, K., Gruissem, W. and Luan, S. (1999) Genes for calcineurin B-like proteins in Arabidopsis are differentially regulated by stress signals. Proceedings of the National Academy of Sciences 96(8): 4718-4723.

Luan, S. (2009) The CBL–CIPK network in plant calcium signaling. Trends in Plant Science 14(1): 37-42.

Luan, S., Kudla, J., Rodriguez-Concepcion, M., Yalovsky, S. and Gruissem, W. (2002) Calmodulins and calcineurin B–like proteins calcium sensors for specific signal response coupling in plants. The Plant Cell Online 14(suppl 1): S389-S400.

Mahajan, S., Sopory, S. K. and Tuteja, N. (2006) Cloning and characterization of CBL-CIPK signalling components from a legume (Pisum sativum). The Federation of European Biochemical Societies Journal 273(5): 907-925.

Mao, J., Manik, S., Shi, S., Chao, J., Jin, Y., Wang, Q. and Liu, H. (2016) Mechanisms and physiological roles of the CBL-CIPK networking system in Arabidopsis thaliana. Genes 7(9): 62.

Mohanta, T. K., Malnoy, M., Mohanta, N. and Kanchiswamy, C. N. (2014) In-silico identification and phylogenetic analysis of auxin efflux carrier gene family in Setaria italica L. African Journal of Biotechnology 13(2): 211-225.

Mohanta, T. K. and Mohanta, N. (2013) Genome wide identification of auxin efflux carrier gene family in physcomitrella patens. Journal of Biotechnological Sciences 1: 54-64.

Mohanta, T. K., Mohanta, N., Mohanta, Y. K., Parida, P. and Bae, H. (2015) Genome-wide identification of Calcineurin B-Like (CBL) gene family of plants reveals novel conserved motifs and evolutionary aspects in calcium signaling events. BioMed Central Plant Biology 15(1): 9-18.

Monihan, S. (2011) The Arabidopsis Calcineurin B-Like10 calcium sensor couples environmental signals to developmental responses. PhD thesis, The University of Arizona, Tucson, United States of America.

Pandey, G. K., Cheong, Y. H., Kim, K. N., Grant, J. J., Li, L., Hung, W. and Luan, S. (2004) The calcium sensor calcineurin B-like 9 modulates abscisic acid sensitivity and biosynthesis in Arabidopsis. The Plant Cell 16(7): 1912-1924.

Pandey, G. K., Kanwar, P., Singh, A., Steinhorst, L., Pandey, A., Yadav, A. K. and Lee, S. C. (2015) CBL-interacting protein kinase, CIPK21, regulates osmotic and salt stress responses in Arabidopsis. Plant Physiology pp- 00623.

Qiu, Q. S., Guo, Y., Dietrich, M. A., Schumaker, K. S. and Zhu, J. K. (2002) Regulation of SOS1, a plasma membrane Na+/H+ exchanger in Arabidopsis thaliana, by SOS2 and SOS3. Proceedings of the National Academy of Sciences 99(12): 8436-8441.

Quan, R., Lin, H., Mendoza, I., Zhang, Y., Cao, W., Yang, Y. and Guo, Y. (2007) SCABP8/CBL10, a putative calcium sensor, interacts with the protein kinase SOS2 to protect Arabidopsis shoots from salt stress. The Plant Cell 19(4): 1415-1431.

Reddy, A. S., Ali, G. S., Celesnik, H. and Day, I. S. (2011) Coping with stresses: roles of calcium-and calcium/calmodulin-regulated gene expression. The Plant Cell 3(6): 2010-2032.

Rudd, J. J. and Franklin‐Tong, V. E. (2001) Unravelling response‐specificity in Ca2+ signalling pathways in plant cells. New Phytologist 151(1): 7-33.

Schlicker, A., Domingues, F. S., Rahnenführer, J. and Lengauer, T. (2006) A new measure for functional similarity of gene products based on gene ontology. BioMed Central Bioinformatics 7(1): 302.

Shao, H., Chu, L., Jaleel, C. A. and Zhao, C. (2008) Water-deficit stress-induced anatomical changes in higher plants. Comptes Rendus Biologies 331(3): 215-225.

Tang, R. J., Liu, H., Yang, Y., Yang, L., Gao, X. S., Garcia, V. J. and Zhang, H. X. (2012) Tonoplast calcium sensors CBL2 and CBL3 control plant growth and ion homeostasis through regulating V-ATPase activity in Arabidopsis. Cell Research 22(12): 1650–1665.

Tang, R. J., Zhao, F. G., Garcia, V. J., Kleist, T. J., Yang, L., Zhang, H. X. and Luan, S. (2015) Tonoplast CBL–CIPK calcium signaling network regulates magnesium homeostasis in Arabidopsis. Proceedings of the National Academy of Sciences 112(10): 3134-3139.

Velásquez, A. C., Chakravarthy, S. and Martin, G. B. (2009) Virus-induced gene silencing (VIGS) in Nicotiana benthamiana and tomato. Journal of Visualized Experiments 28: 1292.

Wang, M., Gu, D., Liu, T., Wang, Z., Guo, X., Hou, W. and Wang, G. (2007) Overexpression of a putative maize calcineurin B-like protein in Arabidopsis confers salt tolerance. Plant Molecular Biology 65(6): 733-746.

Xu, J., Li, H. D., Chen, L. Q., Wang, Y., Liu, L. L., He, L. and Wu, W. H. (2006) A protein kinase, interacting with two calcineurin B-like proteins, regulates K+ transporter AKT1 in Arabidopsis. Cell 125(7): 1347-1360.

Zhang, H., Yin, W. and Xia, X. (2008) Calcineurin B-Like family in Populus: comparative genome analysis and expression pattern under cold, drought and salt stress treatment. Plant Growth Regulation 56(2): 129-140.

Zhu, J. K. (2002) Salt and drought stress signal transduction in plants. Annual Review of Plant Biology 53: 247-273.

Zhu, J. K. (2016) Abiotic stress signaling and responses in plants. Cell 167(2): 313-324.