بیان هم‌زمان ژن‌های 5-انول‌پیروویل‌شیکیمیت-3-فسفات‌سنتاز ((epsps و گلایفوسیت‌اکسیدوردوکتاز ((gox با هدف ارتقای مقاومت به علف‌کش گلایفوسیت در گیاهچه‌های تراریختۀ کلزا

نوع مقاله: مقاله پژوهشی

نویسندگان

1 گروه زیست‌فناوری مولکولی گیاهی،پژوهشکدۀ زیست‌ فناوری کشاورزی، پژوهشگاه ملی مهندسی ژنتیک و زیست فناوری، تهران، ایران

2 گروه زیست‌ فناوری مولکولی گیاهی، پژوهشکدۀ زیست‌ فناوری کشاورزی، پژوهشگاه ملی مهندسی ژنتیک و زیست فناوری، تهران، ایران

چکیده

با‌توجه‌به اهمیت غذایی کلزا (Brassica napus L.)، یکی از مهم‌ترین گیاهان تولیدکنندۀ روغن در جهان، امروزه در بسیاری از کشورها به گسترش سطح زیرکشت این گیاه توجه شده است. حضور علف‌های هرز در مزارع کلزا سبب کاهش درخور توجه میزان تولید و کیفیت محصول این گیاه می‌شود. تاکنون از علف‌کش با طیف گستردۀ گلایفوسیت به‌طور وسیعی استفاده شده است که آنزیم 5-انول پیروویل شیکیمیت-3-فسفات سنتاز (EPSPS) را هدف قرار می‌دهد. در پژوهش حاضر با هدف ارزیابی راهبردهای جدید توسعۀ گیاهان مقاوم به علف‌کش یادشده و به‌منظور توسعۀ گیاهان جدید دارای مقاومت بیشتر، ناقل بیانی pBI121 حامل کاست‌های ژنی گلایفوسیت‌اکسیدوردوکتاز ((gox و epsps جهش‌یافتۀ تحت کنترل پروموتر CaMV 35S به گیاهچه‌های کلزا منتقل شد. پس از غربال‌گری گیاهچه‌های حاصل، گیاهان منتخب به‌منظور تأیید الحاق و رونویسی ژن هدف تجزیه‌وتحلیل مولکولی شدند و ازنظر مقایسۀ سطح تحمل به علف‌کش ارزیابی زیستی شدند. نتایج بررسی لاین‌های تراریخت حاصل از راه gPCR و RT-PCR نشان‌دهندۀ انتقال و بیان موفق تراژن‌های یادشده بودند. آزمون زیستی نیز بروز مقاومت نسبی در لاین‌های بیان‌کنندۀ هم‌زمان دو سازۀ ژنی در مقایسه با نمونه‌های غیرتراریخت و لاین‌های تراریخت تک‌ژنی را نشان داد. مطالعۀ حاضر نشان می‌دهد دو راهبرد مختلف یعنی جلوگیری از اتصال علف‌کش به جایگاه هدف و سم‌زدایی آن به‌طور هم‌زمان به مقاومت بیشتر و پایدارتری نسبت به گلایفوسیت به‌ویژه در گیاهان دانه‌روغنی نظیر کلزا منجر می‌شود.

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Simultaneous expression of 5-enol pyruvyl shikimate 3-phosphate synthase (epsps) and glyphosate oxidoreductase (gox) in transgenic canola plants towards enhancing resistance to glyphosate herbicide

نویسندگان [English]

  • Amir mousavi 1
  • Ali Hatef Salmanian 2
  • Mohammad Reza Eftekhariyan Ghamsari 2
  • Sepideh Parvanian 2
1 Plant Molecular Biotechnology Department, Agricultural Biotechnology Institute, National Institute of Genetic Engineering and Biotechnology, Tehran, Iran
2 Plant Molecular Biotechnology Department, Agricultural Biotechnology Institute, National Institute of Genetic Engineering and Biotechnology, Tehran, Iran
چکیده [English]

Canola (Brassica napus L.) is known as one of the most important oil-producing plants worldwide that has a high food value. Today, expansion of planting area of this plant has been highly considered. The presence of weeds in canola fields causes a significant loss in crop yield and quality. So far, the most widely herbicide used to manage weeds is the broad spectrum glyphosate that targets 5 enolpyruvylshikimate-3-phosphate synthase (EPSPS) enzyme.  In this study, with the aim of identification of new strategies to develop herbicides-resistant plants, Glyphosate Oxidoreductase (gox) and epsps genes under the control of CaMV 35S promoter were transferred to canola seedlings with pBI121 expression vector, to develop new plants with higher herbicide resistance level. Acquired seedlings were screened and then subjected to herbicide resistance bioassay. Molecular analysis of transgenic lines through PCR and RT-PCR showed successful integration and expression of the transgene, respectively. Result showed the higher relative resistance of the transgenic lines expressing two gene cassettes compared to single gene cassette lines. This study suggests that simultaneous application of two different strategies can lead to more glyphosate-resistance to develop new genetically modified crops specifically in oilseed plants such as canola.

کلیدواژه‌ها [English]

  • Transgenic
  • epsps
  • Brassica napus
  • glyphosate
  • gox

گیاه دانه‌روغنی کلزا (Brassica napus L.) از گیاهان مهم زراعی متعلق به تیرۀ کلمیان (Brassicaceae) است (Elahi et al., 2016)؛ علاوه بر مصرف گستردۀ کلزا برای تهیۀ روغن‌های خوراکی، این گیاه منبع مهمی برای تغذیۀ حیوانات است و روغن آن در صنعت و سوخت‌های زیستی استفاده می‌شود. گسترش سطح زیرکشت و تولید کلزا به علت وجود تنش‌های زیستی و غیرزیستی در ایران محدود شده است. مصرف جهانی کلزا طی چهاردهۀ اخیر 8 برابر شده و طبق آمار فائو، تولید این محصول در سال 2014 به 8/73 میلیون تن رسیده است؛ این افزایش روبه‌رشد مصرف، نیاز به بهبود ویژگی‌های ژنتیکی این گیاه از راه زیست‌فناوری مدرن را مطرح می‌کند Ziaei et al., 2016). نخستین گیاهان تراریخت تجاری مقاوم به علف‌کش در سال 1996 تولید شدند و پس‌از‌آن، محصولات زیادی ازجمله سویا، ذرت، پنبه و کلزای تراریخته مجوز سازمان غذا و داروی امریکا را دریافت کردند (Zhang et al., 2016)؛ در سال‌های اخیر، ارقام کلزای تراریخت مقاوم به علف‌کش توسعه و محصولات تراریخت مقاوم به علف‌کش به‌سرعت در سراسر جهان گسترش یافته‌اند و فواید کشت آنها مدنظر قرار گرفته‌اند؛ به‌طوری‌که طی ۲۱ سالی که از کشت انبوه و تجاری محصولات تراریخت می‌گذرد، صفت مقاومت به علف‌کش با ‌عنوان صفت غالب بیشترین درصد سطح کشت این محصولات را به خود اختصاص داده است (Duke, 2015; Shaner, 2014)..

دو رقم کلزای مقاوم به گلوفوسینیت- آمونیوم و گلایفوسیت و همچنین محصولات هیبرید مقاوم به این دو علف‌کش تولید شده‌اند (Oliver et al., 2016). علف‌کش با طیف گستردۀ گلایفوسیت آنزیم 5-انول‌پیروویل‌شیکیمیت-3-فسفات‌سنتاز (EPSPS) در مسیر شیکیمات را مهار می‌کند. این آنزیم واکنش تبدیل شیکیمیت-3-فسفات (S3P) و فسفوانول‌پیرووات (PEP) به 5-انول‌پیروویل‌شیکیمیت-3-فسفات را کاتالیز می‌کند که مرحلۀ مهمی در بیوسنتز اسیدهای آمینۀ آروماتیک در گیاهان است. ابتدا گلایفوسیت علف‌کشی غیرانتخابی و درنهایت علف‌کشی انتخابی با سازگاری محیطی زیاد برای محصولات تراریخت مقاوم به گلایفوسیت و پرمصرف‌ترین علف‌کش استفاده‌شده در جهان مطرح شد. محل هدف مشخص، توانایی رفتن به بافت‌های گیاه، خطر سمیت کم برای انسان و سایر جانوران از دیگر ویژگی‌های این علف‌کش هستند که از راه فناوری محصولات تراریخته، روش کارآمدی برای مبارزه با علف‌های هرز در اختیار کشاورزان قرار داده‌اند (Chhapekar et al., 2015; Han et al., 2016). به‌کارگیری آنزیم هدف EPSPS و سمیت‌زدایی مولکول گلایفوسیت دو راهبرد اساسی برای توسعۀ موفقیت‌آمیز محصولات مقاوم به گلایفوسیت هستند. راهبرد اول در بیشتر محصولات تجاری مقاوم به گلایفوسیت با به‌کارگیری دو شکل جهش‌یافته و مقاوم ذاتی آنزیم EPSPS استفاده شده است. این روش ازنظر تئوری معایبی مانند باقی‌ماندن گلایفوسیت و تجمع آن در مناطق مریستمی گیاه دارد که ممکن است به بروز برخی ویژگی‌های نامطلوب مانند جلوگیری از توسعۀ اندام‌های تولیدمثلی و در نتیجه بازدۀ کمتر محصول منجر شود. روش دوم به علت به‌کارگیری سازوکاری کاربردی برای حذف باقیمانده‌های علف‌کش، راهکار مکملی برای روش اول است .(Dun et al., 2014; Sammons and Gaines, 2014). سمیت‌زدایی گلایفوسیت از دو مسیر انجام می‌شود: مسیر اول به تولید فسفات و سارکوزین منجر می‌شود و روش دیگر با استفاده از آنزیم گلایفوسیت‌اکسیداز (GOX) سبب تولید آمینومتیل‌فسفونیک‌اسید (AMPA) و گلی‌اکسیلات می‌شود. در برخی رخدادهای تراریخت کلزا از GOX در ترکیب با EPSPS به‌طور تجاری استفاده شده است (Dill, 2005)؛ درحالی‌که در کشور ما، بهره‌برداری از ژن‌های به‌کاررفته و برخی عوامل کنترل‌کنندۀ بیان در این رخدادهای تجاری به علت وجود حقوق مالکیت فکری شرکت‌های تولیدکنندۀ آنها ممکن نیست. در مطالعۀ حاضر با هدف رسیدن به سطوح مقاومت مطلوب‌تر، دو ژن gox با توالی سنتز و بهینه‌شده و epsps جهش‌یافته به‌طور هم‌زمان وارد گیاهچه‌های کلزا شدند. تاکنون ترکیب این دو ژن ویژه و عوامل کنترل‌کنندۀ بیان آنها به‌طور هم‌زمان ارزیابی نشده است. تجزیه‌وتحلیل میزان مقاومت به گلایفوسیت نشان داد بیان هم‌زمان ژن‌های gox و epsps در لاین‌های کلزای تراریخت به تغییراتی در سطوح مقاومت آنها در برابر علف‌کش نسبت به گیاهان تراریخت حاوی یکی از دو ژن منجر می‌شود. یافته‌های حاضر می‌‌توانند به استفاده از ایده‌های برتر برای توسعۀ محصولات تراریخت نسل جدید به‌ویژه در گیاهان دانه‌روغنی منتج شوند؛ این مهم با در نظر گرفتن واردات بیش از ۹۰ درصدی روغن‌های خوراکی کشور و ضرورت توسعۀ سطح زیرکشت این محصولات از راه مدیریت بهینۀ علف‌های هرز بیش‌از‌پیش اهمیت می‌یابد.

 

مواد و روش‌ها

ساخت سازه‌های ژنی: ساخت سازۀ حاوی دو کاست ژنی با استفاده از سازه‌های تک‌ژنی حاوی ژن‌های epsps و gox انجام شد که در گذشته به‌تنهایی برای تولید گیاهان مقاوم به علف‌کش در پژوهشگاه ملی مهندسی ژنتیک و زیست‌فناوری استفاده شده بودند (Kahrizi et al., 2007; Hadi et al., 2012). یکی از ژن‌های استفاده‌شده در پژوهش حاضر، ژن آنزیم EPSPS باکتری E. coli(با شماره توالی X00557 در بانک‌های ژنی) بود. این ژن دارای دو جهش گلایسین ٩٦ به آلانین (GAA به CAA) و آلانین ۱٨٣ به ترئونین (GCG به ACC) است و mutII نام دارد که پیش‌ازاین، Kahrizi و همکاران (2007) آن را همسانه‌سازی کرده‌اند. ژنgox  دارای منشأ پروکاریوت و غنی از آدنین و ‌تیمین (AT) است و رمزهای آن برای بیان زیاد در سیستم گیاهی مناسب نیستند. Hadi و همکاران در سال 2012 رمزهای دارای بیشترین بیان در گیاه کلزا را انتخاب و با هدف ساخت ژن مصنوعی gox جایگزین رمزهای نادر موجود در ترادف ژنی کردند..

یک جفت آغازگر اختصاصی برای تکثیر توالی ژن gox، پروموتر CaMV 35S و پایان‌دهندۀ Nos از روی ناقل pBI121 طراحی و جایگاه آنزیم برشی EcoRI در دو سر آن تعبیه شد. از واکنش زنجیره‌ای پلیمراز (PCR) برای تکثیر قطعۀ مدنظر از روی ناقل pBI121 حاوی ژن مصنوعی استفاده شد. محصول در جایگاه EcoRI در پایین‌دست کاست ژنی CaMV 35S-epsps-Nos روی ناقل pBI121 قرار داده شد. سازۀ بیانی نوترکیب حاصل با روش شوک گرمایی به آگروباکتری سویۀ LBA4404 منتقل شد. تمام مراحل انتقال ژن به گیاه کلزا (شکل 1) و باززایی گیاهچه‌ها بر اساس روش آلوده‌سازی قطعه‌های دمبرگ لپه‌ای با سوسپانسیون آگروباکتری انجام شدند (Moloney et al., 1989).

 

 

 

شکل 1- مراحل انتقال سازۀ ژن هدف به گیاه کلزا و غربال گیاهان تراریخت از غیرتراریخت. a. کشت بذر گیاه کلزا در محیط جوانه‌زنی، b. دانهال‌های رشدیافته در وضعیت چهارروزه، c. کشت دمبرگ‌های لپه‌ای جدا‌شده از گیاه در محیط پیش‌کشت، d. آلوده‌سازی ریزنمونه‌ها با سوسپانسیون آگروباکتری (1-5/0OD=)، e. جوانه‌زنی دمبرگ‌های لپه‌ای در محیط انتخابی حاوی کانامایسین، f. باززایی نوساقه‌های سبز تراریخت احتمالی در محیط طویل‌سازی نوساقه

 


ارزیابی مولکولی گیاهان تراریخت: DNA ژنومی با بافر CTAB از برگ‌های جوان گیاهچه‌های باززایی‌شده استخـراج و گیاهچه‌های تراریخت احتمالی با PCR و آغازگرهای اختصاصی تراژن‌ها (جدول 1) غربال‌گری شدند (Murray and Thompson, 1980). به‌منظور تأیید بیان تراژن‌ها در سطح رونویسی در گیاهان تراریخت، بافت تازۀ برگی برداشت و RNA تام با بافر RNX-Plus (SinaClon) استخراج شد. پس از تأیید کیفیت RNA با الکتروفورز و اسپکتروفوتومتری در طول موج‌های 260 و 280 نانومتر، 2 میکروگرم RNA به‌عنوان الگو در ساخت cDNA با استفاده از آنزیم نسخه‌بردار معکوس (RT) استفاده شد (Hadi et al., 2012)؛ پس از ساخت cDNA و تعیین رقت مناسب، از آن به‌عنوان الگو برای تکثیر ژن‌های gox و epsps در واکنش PCR و با استفاده از آغازگرهای اختصاصی ژن برای تأیید بیان ژن‌ها در گیاهچه‌های تراریخت استفاده شد.

 

جدول 1- ویژگی‌های آغازگرهای به‌کاررفته در مطالعۀ حاضر

نام آغازگر

(5'-à3'توالی (

دمای ذوب

اندازۀ قطعۀ تکثیرشده (جفت باز)

Synth gox F

GGATCCACCACCATGTCG

59oC

1314

Synth gox R

AGCTCTCAGGAGGCAGGAC

59oC

 

EPSPS F

ATGGAATCCCTGACGTTACA

60oC

1350

EPSPS R

TCAGGCTGCCTGGCTAATC

60oC

 

 


آستانۀ مقاومت لاین‌های تراریخت در محیط حاوی علف‌کش: بذرهای حاصل از گیاهان T0 در شیب غلظت صفر تا 1 میلی‌مولار علف‌کش گلایفوسیت (اضافه‌شده به محیط‌کشت MS استریل پیش از اتوکلاو) در شرایط درون‌شیشه (in vitro)کشت داده شدند. برای هر بذر ۵ تکرار در نظر گرفته شد. حد مقاومت گیاهچه‌های دوژنی ریشه‌دار‌شده با گیاهچه‌‌های تک‌ژنی و گیاهچه‌های شاهد غیر‌تراریخته در سن‌های 14 و 21 روزه مقایسه شد (Dun et al., 2014)؛ معیار حد مقاومت، حفظ شادابی و طراوت ساقه‌ها و سبزینگی برگ‌ها در نظر گرفته شد.

 

نتایج

محصول 2700 جفت‌بازی تکثیرشده از روی ناقل pBI121 حاوی ژن gox و ناقل pBI121 حاوی ژن epsps به‌طور هم‌زمان با آنزیم EcoRI هضم و ناقل جدید حاوی ژن‌های epeps و gox طی واکنش اتصال ساخته شد (شکل 2). باتوجه‌به الگوی الکتروفورزی محصولات نتیجه ‌گرفته می‌شود دو سازۀ ژنی در جهت مخالف یکدیگر و مطابق شکل 2 قرار گرفته‌اند.

تأیید همسانه‌سازی دو ژن gox و epsps در ناقل بیانی pBI121 با PCR و هضم آنزیمی انجام شد. سازه‌های‌ ژنی به میزبان آگروباکتری انتقال یافتند. حضور سازه‌ها در میزبان جدید با غربال‌گری PCR ارزیابی شد (شکل ٣).

 

شکل 2- نقشۀ شماتیک کاست‌های ژنی ناقل نوترکیب دوکاسته و نمایش جهت‌گیری دو کاست ژنی epsps و gox. Kan R. ژن نئومایسین‌فسفوترانسفراز (نشانگر انتخابی)، NOS. ژن پایان‌دهندۀ نوپالین‌سنتاز، 35S. آغازگر

 

 

شکل ٣- الگوی الکتروفورز غربال‌گری PCR انتقال سازه‌ در آگروباکتری روی ژل آگارز ۱ درصد. چاهک‌ها به‌ترتیب شماره 2 تا 8. محصول PCR تکثیر ژن epsps (قطعۀ 1350 جفت‌بازی)، 9 تا 15. محصول PCR ژن gox (قطعۀ 1314 جفت‌بازی) با آغازگرهای synth-gox F و synth-gox R، چاهک شمارۀ ۱. pUC-gox (شاهد مثبت)، چاهک شمارۀ ۱٦. شاهد منفی بدون الگو، M. نشانگر وزن مولکولی 1kb (Fermentas)

 

به‌منظورغربال‌گری گیاهچه‌های تراریخت‌شده، پس از استخراج DNA ژنومی، PCR با آغازگرهای اختصاصی تراژن‌های gox و epsps انجام شد و محصولات آن روی ژل آگارز ۱ درصد الکتروفورز شدند. مشاهدۀ محصولات PCR با اندازه‌های ۱٣۱۴ جفت‌باز و ۱٣٥۰ جفت‌باز تلفیق موفق تراژن در ژنوم لاین‌های بررسی‌شده را تأیید می‌کند (شکل 4).

 

 

شکل 4- الف. الکتروفورز نمونه‌های DNA ژنومی استخراج‌شده از گیاهان کلزا روی ژل آگارز 1 درصد. چاهک شمارۀ ۱. گیاه غیرتراریخت، چاهک‌های ٢ تا ١۵. نمونه‌های حاصل از گیاهان تراریخت، ب. الکتروفورز محصولات PCR مربوط به DNA ژنومی استخراج‌شده از گیاهان تراریخت کلزا با آغازگرهای اختصاصی ژن gox، ج. الکتروفورز محصولات PCR مربوط به DNA ژنومی استخراج‌شده از گیاهان تراریخت کلزا با استفاده از آغازگرهای اختصاصی ژن epsps، چاهک شمارۀ 1. ناقل پلاسمیدی pBI121-gox-epsps (شاهد مثبت)، چاهک ۱٦. محصول PCR گیاه غیرتراریخت (شاهد منفی)، چاهک M. نشانگر وزن مولکولی1 kb  (Fermentas)

به‌منظور بررسی رونویسی ژن مدنظر در گیاهان تراریخت، RNA تام از بافت برگ‌های تازه استخراج شد. برای اطمینان از RNA استخراجی، مقداری از آن روی ژل آگارز 8/0 درصد الکتروفورز شد (شکل 5).

 

 

شکل 5- الف. الگوی الکتروفورزی RNA کل در گیاهان بررسی‌شده روی ژل آگارز ٨/۰ درصد، ب. چاهک ۱: محصولPCR  از DNA ژنومی گیاه غیرتراریخت، چاهک شمارۀ ۲: کنترل منفی بدون الگوی DNA، چاهک‌های ٣ تا ۱٦: الکتروفورز محصول RT-PCR گیاهان تراریخت‌شده با آغازگرهای ژن درون‌زاد TUB F/TUB R روی ژل آگارز ۱ درصد، M: نشانگر وزن مولکولی 100 جفت‌بازی (Fermentas)

 

قطعه‌های واضح‌تر به RNA زیرواحدهای ریبوزومی مربوط هستند. پس از ساخت cDNA، PCR برای ساختار مدنظر انجام و از ژن خانه‌دار توبولین (شاهد داخلی) استفاده شد. در شکل 6، الکتروفورز محصول RT-PCR حاصل از گیاهان تراریخت‌شده مشاهده می‌شود.

 

شکل 6- بررسی رونویسی از ژن‌های gox و epsps در گیاهان تراریخت‌شده روی ژل آگارز ۱درصد. الف. الکتروفورز محصول RT-PCR گیاهان تراریخت با آغازگرهای اختصاصی gox، ب. الکتروفورز محصول RT-PCR از cDNA تهیه‌شده ازگیاهان تراریخت با آغازگرهای اختصاصی epsps. چاهک ۱: محصول PCR از DNA ژنومی گیاه غیرتراریخت، چاهک ۲: محصول  PCRاز cDNA تهیه‌شده از گیاهان تراریخت بدون آنزیم Reverse  Transcriptase (شاهدRT –)، چاهک‌های ۴ تا 23: محصول PCR از cDNA تهیه‌شده از گیاهان تراریخت احتمالی، M: نشانگروزن مولکولی   100bp(Fermentas)

 

درنهایت، میزان مقاومت به علف‌کش گلایفوسیت در جوانه‌های تراریخت دارای دو کاست ژنی با گیاهان تراریخت تک‌ژنی و گیاهچه‌های شاهد غیر‌تراریخت در شرایط کشت درون‌شیشه (in vitro) بررسی و مقایسه شد. طی این بررسی، آستانۀ مقاومت گیاهچه‌ها در غلظت‌های مختلف صفر، 05/0، 1/0، 25/0، 4/0 و 1 میلی‌مولار گلایفوسیت بررسی و قابلیت حفظ رشد، طراوت و سبزینگی طبیعی آنها مد‌نظر قرار گرفت. نتایج در جدول 2 ارائه شده‌اند.

جدول 2- نتایج میزان مقاومت جوانه‌های تراریخت حاوی سازه‌های ژنی مختلف به گلایفوسیت

سازه ژنی انتقال‌یافته

میزان مقاومت (میلی‌مولار)

pBI121-epsps-gox

۴/۰

pBI121-epsps

۲٥/۰

pBI121-gox

۱/۰

Wild type

05/0

 

بحث

دانه‌های روغنی کلزا بخش زیادی از روغن خوراکی جهان (13 تا 16 درصد بین سال‌های 1999 تا 2009) را تولید می‌کنند (Hannoufa et al., 2014). روغن کلزا به علت مقدار کم اسیدهای چرب ازجمله سالم‌ترین روغن‌ها به شمار می‌رود (Elahi et al., 2016). کشف علف‌کش‌های سنتتیک در سال 1945 بزرگ‌ترین دستاورد فناورانه بود که مدیریت علف‌ها را به‌سرعت تغییر داد. کشاورزان به ‌مدت60 سال و تا پیش از معرفی محصولات مقاوم به علف‌کش، از علف‌کش‌های انتخابی استفاده می‌کردند (Green, 2014) و تشخیص علف‌ها و طراحی راهبردهای مبارزه با آنها، فرایند وقت‌گیری برای کشاورزان بود. پس از معرفی محصولات مقاوم به علف‌کش، در بیشتر مواقع کاربرد گلایفوسیت به‌تنهایی تمام علف‌های هرز را کنترل می‌کرد. محصولات تراریخت با ویژگی مقاومت به علف‌کش مدیریت علف‌های هرز را آسان، مؤثر و کارآمد کردند. صرفۀ اقتصادی، افزایش محصول، کاهش آثار زیست‌محیطی از دیگر عوامل همه‌گیرشدن این فناوری هستند (Green, 2014; Brookes, 2014).

نخستین‌بار در سال 1999، کلزای مقاوم به گلایفوسیت و یا گلوفوسینیت کشت شد. این گیاه در کانادا، امریکا و به‌تازگی در استرالیا کشت شده است. دستاورد مالی محصولات مقاوم به علف‌کش در جهان 481 میلیون دلار در سال 2012 بوده است (Brookes and Barfoot, 2012)؛ کانادا با تولید سالانه 6 میلیون هکتار بزرگ‌ترین تولیدکنندۀ کلزای تراریخت در جهان است (Beckie and Hall, 2014). در تولید اکثر گیاهان تراریخت مقاوم به گلایفوسیت، غالباً از یک ژن (epsps نوع مقاوم) استفاده شده است؛ درحالی‌که در برخی رخدادهای دیگر ازجمله کلزای GT200 به‌طور هم‌زمان از دو ژن cp4 epsps (با منشأ Agrobacterium tumefaciens cp4) و ژن gox247 (با منشأ Ochrobactrum anthropic strain LBAA) استفاده شده است. برای کنترل بیان و هدفمندسازی کلروپلاستی محصول این دو ژن به‌ترتیب از پروموتر Figwort Mosaic Virus (FMV) و پپتید نشانۀ کلروپلاستی با منشأ گیاه آرابیدوپسیس بهره‌گیری شده است. در مطالعۀ حاضر، باتوجه‌به ممکن‌نبودن استفاده از ژن‌های دارای حقوق مالکیت فکری ثبت‌شده و پیشینۀ پژوهش‌های قبلی تیم کاری ما، از epsps با منشأ E. coli (k12) دارای جهش‌های نقطه‌ای (شامل گلایسین 96 به آلانین و آلانین 183 به ترئونین) و توالی gox سنتز‌شده با کدون‌های بهینه‌شده برای گیاه کلزا و ساختار ثانویۀ اصلاح‌یافتۀ mRNA، هردو تحت کنترل پروموتر 35S ویروس موزاییک گل کلم (CaMV 35S) استفاده شد. مطالعۀ حاضر برای نخستین‌بار ترکیب و کارایی این دو ژن ویژه را به‌طور هم‌زمان در گیاه کلزا ارزیابی می‌کند تا برای هدف نهایی تجاری‌سازی گیاه مقاوم بهره‌برداری شود. در پژوهش حاضر، گیاهان تراریخت دارای دو کاست ژنی epsps و gox در مقایسه با گیاهان تراریخت دارای یکی از ژن‌های gox و epsps  قدرت تحمل بیشتری در محیط‌کشت حاوی علف‌کش داشتند؛ احتمالاً علت این مشاهده اینست که EPSPS نوع جهش‌یافته باعث کاهش میل ترکیبی علف‌کش گلایفوسیت به آنزیم می‌شود و به این ترتیب، تحمل گیاه را افزایش می‌دهد؛ این در حالیست که GOX هم‌زمان گلایفوسیت تجمع‌یافته را به مواد غیرسمی تجزیه می‌کند و علاوه بر اثر افزایشی آن در ارتقای سطح تحمل گیاه، از آثار ناخواستۀ علف‌کش تجمع‌یافته روی ویژگی‌های فیزیولوژیک (به‌ویژه روی اندام‌های زایشی) ممانعت می‌کند. گفتنی است برای افزایش مقاومت گیاهان به مقادیر زیاد علف‌کش (بیشتر از 5/0 میلی‌مولار)، استفاده از ژن‌های epsps با مقاومت ذاتی (کلاسII) و نیز پپتیدهای نشانۀ کلروپلاستی با کارایی مناسب در گیاه کلزا (هدفمندسازی خوب و شکسته‌شدن به‌موقع توالی) و نیز بهره‌گیری از توالی‌های تشدید‌کننده در بالادست ژن ضروری هستند. ترکیب راهبردهای مختلف در توسعۀ محصولات مقاوم به گلایفوسیت مهم است. دو آنزیم گلیفوسیت‌اکسیدوردوکتاز و گلیفوسیت‌استیل‌ترانسفراز توانایی سمیت‌زدایی گلایفوسیت را دارند. تاکنون محصولات بسیاری شامل ذرت، سیب زمینی، سویا، چغندرقند و گوجه با دو ژن cp4 وgox تراریخت شده‌اند (Dun et al., 2014). پیش‌از‌این، انتقال توأم ژن مقاومت به آفت (Bt) و ژن مقاومت به گلایفوسیت در یک ناقل T-DNA برای انتقال به برنج با استفاده از آگروباکتری انجام شده است (Zhao et al., 2015). مقایسۀ قدرت جوانه‌زنی بذرها و میزان مقاوت نسل‌های بعدی گیاهان تراریخت دوکاسته با گیاهان تک‌کاسته و بذرهای غیرتراریخت (Wt) در غلظت‌های مختلف گلایفوسیت در پژوهش‌های بعدی پیشنهاد می‌شود.

 

سپاسگزاری

نویسندگان از پژوهشگاه ملی مهندسی ژنتیک و زیست‌فناوری برای تأمین اعتبار مالی پروژۀ حاضر (طرح مأموریت‌محور ۴۰۷-م) سپاسگزاری می‌کنند.

Beckie, H. J. and Hall, L. M. (2014) Genetically-modified herbicide-resistant (GMHR) crops a two-edged sword? An Americas perspective on development and effect on weed management. Crop Protection 66: 40-45.

Brookes, G. (2014) Weed control changes and genetically modified herbicide tolerant crops in the USA 1996-2012. GM Crops & Food 5(4): 321-332.

Brookes, G. and Barfoot, P. (2014) Economic impact of GM crops: the global income and production effects 1996-2012. GM Crops & Food 5(1): 65-75.

Chhapekar, S., Raghavendrarao, S., Pavan, G., Ramakrishna, C., Singh, V. K., Phanindra, M. L., Dhandapani, G., Sreevathsa, R. and Ananda Kumar, P. (2015) Transgenic rice expressing a codon-modified synthetic CP4-PSPS confers tolerance to broad-spectrum herbicide, glyphosate. Plant Cell Reports 34(5): 721-731.

Dill, G. M. (2005) Glyphosate‐resistant crops: history, status and future. Pest Management Science 61(3): 219-224.

Duke, S. O. (2015) Perspectives on transgenic, herbicide‐resistant crops in the United States almost 20 years after introduction. Pest Management Science 7(5): 652-657.

Dun, B., Xujing, W., WeiLu, M., Chenb, W. and Zhangb, S. H. (2014) Development of highly glyphosate-tolerant tobacco by coexpression of glyphosate acetyltransferase gat and EPSPS G2-aroA genes. The Crop Journal 2(2): 164-169.

Elahi, N., Duncan, R. W. and Stasolla, C. (2016) Modification of oil and glucosinolate content in canola seeds with altered expression of Brassica napus LEAFY COTYLEDON. Plant Physiology and Biochemistry 100: 52-63.

Green, J. M. (2014) Current state of herbicides in herbicide‐resistant crops. Pest Management Science 70(9): 1351-1357

Hadi, F., Mousavi, A., Salmanian, A. H., Akbari, N. and Khajeh, K. H. (2012) Glyphosate tolerance in transgenic canola by a modified glyphosate oxidoreductase (gox) gene. Progress in Biological Sciences 2(1): 50-58.

Han, H., Yu, Q., Widderick, M. J. and Powles, S. B. (2016) Target‐site EPSPS Pro‐106 mutations: sufficient to endow glyphosate resistance in polyploid Echinochloa colona? Pest Management Science 72(2): 264-271.

Hannoufa, A., Pillai, B. V. and Chellamma, S. (2014) Genetic enhancement of Brassica napus seed quality. Transgenic Research 23(1): 39-52.

Kahrizi, D., Salmanian, A. H., Afshari, A., Moieni, A. and Mousavi, A. (2007) Simultaneous substitution of Gly96 to Ala and Ala183 to Thr in 5-enolpyruvylshikimate-3-phosphate synthase gene of E. coli (k12) and transformation of rapeseed (Brassica napus L.)in order to make tolerance to glyphosate. Plant Cell Reports 26(1): 95-104.

Moloney, M. M., Walker J. M. and Sharma, K. K. (1989) High efficiency transformation of Brassica napus using Agrobacterium vectors. Plant Cell Reports 8(4): 238-242.

Murray, M. and Thompson, W. F. (1980) Rapid isolation of high molecular weight plant DNA. Nucleic Acids Research 8(19): 4321-4326

Oliver, D. P., Kookana, R. S., Miller, R. B. and Correll, R. L. (2016) Comparative environmental impact assessment of herbicides used on genetically modified and non-genetically modified herbicide-tolerant canola crops using two risk indicators. Science of the Total Environment 557: 754-763.

Sammons, R. D. and Gaines, T. A. (2014) Glyphosate resistance: state of knowledge. Pest Management Science 70(9): 1367-1377.

Shaner, D. L. (2014) Lessons learned from the history of herbicide resistance. Weed Science 62(2): 427-431.

Zhang, C., Wohlhueter, R. and Zhang, H. (2016) Genetically modified foods: A critical review of their promise and problems. Food Science and Human Wellnes 5: 116-123.

Zhao, Q., Liu, M. H., Zhang, X. W., Lin, C. Y., Zhang, Q. and Shen, Z. C. (2015) Generation of insect-resistant and glyphosate-tolerant rice by introduction of a T-DNA containing two Bt insecticidal genes and an EPSPS gene. Journal of Zhejiang University Science 16(10): 824-831.

Ziaei, M., Motallebi, M., Zamani, M. R. and Panjeh, N. (2016) Co-expression of chimeric chitinase and a polygalacturonase-inhibiting protein in transgenic canola (Brassica napus) confers enhanced resistance to Sclerotinia sclerotiorum. Biotechnology Letters 38(6): 1021-1032.