تأثیر عصاره گیاه دارویی مرزنجوش بر بیان برخی ژن‌های دخیل در مقاومت به عامل بیماری سپتوریوز برگی در دو رقم گندم چمران و یاواروس

نوع مقاله: مقاله پژوهشی

نویسندگان

1 1- کارشناس ارشد، گروه زراعت و اصلاح نباتات، دانشکده کشاورزی، دانشگاه ایلام

2 استادیار گروه زراعت و اصلاح نباتات، دانشکده کشاورزی، دانشگاه ایلام، کد پستی: 69391177111

3 سازمان جهاد کشاورزی استان ایلام، ایلام، ایران

چکیده

بیماری سپتوریوز برگی گندم، که عامل آن قارچ Mycosphaerella graminicola می باشد، یکی از مخرب‏ترین بیماری‏های گندم است. ارقام مقاوم و سموم شیمیایی دو روش معمول جهت کنترل این بیماری می‌باشند. دراین تحقیق تاثیر عصاره گیاه دارویی مرزنجوش بر القا مقاومت در دو رقم حساس و مقاوم گندم بررسی گردید. آزمایش در دو شرایط کنترل (بدون عصاره) و تیمار(عصاره) روی دو رقم گندم چمران (مقاوم) و یاواروس (حساس) در گلخانه انجام گرفت. دو روز بعد از تیمار عصاره، آلودگی دو رقم با ایزوله قارچ سپتوریوز دهلران جلیزی به مقدار 105 7 اسپور در میلی‌لیتر آلوده شدند. RNA و سنتز cDNA از نمونه‌های برگی در سه زمان 6، 12و 24 ساعت بعد از آلودگی جهت آنالیزهای بعدی تهیه گردید. نتایج نشان داد که میزان بیان ژن PR1 در زمان‌های مختلف بین دو رقم مقاوم و حساس بعد از عصاره‌پاشی و آلودگی با ایزوله قارچ بسیار متفاوت است، به طوری که این میزان بعد از 6 ساعت به 5/2 برابر رقم حساس رسید. اما میزان بیان ژن Ppi بعد از 6 ساعت تیمار،‌ در رقم یاواروس تقریباً 5/2 برابر رقم چمران مشاهده شد. به کاربردن عصاره مرزنجوش باعث افزایش بیان ژن PR1 در رقم مقاوم گردید در حالی که بیان ژن Ppi در رقم حساس افزایش یافت. لذا با توجه به اینکه بیان ژن Ppi پس از 24 ساعت بعد از آلودگی در رقم حساس سه برابر رقم مقاوم شد. پیشنهاد می‌شود که به کار بردن عصاره متانلی گیاه دارویی مرزنجوش می تواند سبب القا مقاومت و فعال شدن سیستم دفاعی گیاه در مقابل پاتوژن قارچی M. graminicola باشد.

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

The effect of Marjrom medicinal herb extract on the expression of some genes involve in resistance to Septoria tritici leaf blotch in two wheat Chamran and Yavarous cultivars

نویسندگان [English]

  • AKram Abasi Manesh 1
  • Arash Fazeli 2
  • siamak beigi 3
1 1- Master of science, agronomy and plant breeding department, faculty of agriculture, Ilam
2 Assistants professor of agronomy and plant breeding department, faculty of agriculture, ilam university, Ilam, Iran. postal code: 69391177111
3 Agricultural Jahad organization of Ilam Province, Ilam, Iran
چکیده [English]

Leaf Septoria tritici anamorph Mycosphaerella graminicola is one of the main destructive foliar disease of wheat. Resistance cultivars and chemical pesticide are commonly methods that used to control of disease. In this research, the effect of Marjoram extract was investigated in order to induction of resistance in two resistance and sensitive cultivars of wheat. Experiment was conducted in control (without extract) and treatment (extract) conditions on resistance (Chamran) and sensitive (Yavarous) cultivar at greenhouse condition. Two days after treatment of seedling with extract, inoculation of plants had been done with Dehloran isolate of septoria tritici with 7×105spore/ml. RNA extraction and cDNA synthesis from leaf samples were prepared at 6, 12 and 24 hours after contamination for further analysis. The results showed that the expression of PR1 gene at investigated times between two cultivars at two conditions was different so that the PR1 gene expression was peaked at 6 h 2.5 fold change rather than sensitive cultivar, while the expression of Ppi gene 6h after inoculation was calculated in Yavarous show 2.5fold change rather than Chamran cultivar. Application of Marjrom extract increased the expression of PR1 gene in resistance cultivar, while Ppi gene expression increased in sensitive cultivar three fold changes. It is suggested that the use of methanolic extracts of Marjoram medicinal plant can induce resistance and activation of the plant defense system against M. graminicola fungal pathogen.

کلیدواژه‌ها [English]

  • septoria tritici disease
  • extract medical plant
  • wheat resistance
  • Real Time-PCR

گندم نان (Triticum aestivum L.) غذای اصلی بشر در بسیاری از نقاط جهان است که در سال 2013 بیش از 714 میلیون تن در جهان تولید شده است Kiss et al., 2014)). با‌توجه‌به افزایش روزافزون جمعیت، برای پاسخ‌گویی به نیاز کشورهای در حال توسعه تا سال 2050 به 60 درصد افزایش در واحد تولید گندم نیاز است (Singh and Trethowan., 2007; Singh et al., 2007). ازسویی تنش‌های زنده و غیرزنده عامل اصلی محدود‌کنندة تولید گندم هستند ‌که بین آنها بیماری‌های قارچی تهدیدی جدی‌ برای شکاف بین عملکرد واقعی و دست‌یافتنی در گندم هستند (Goutam et al., 2013) قارچ Mycosphaerella graminicola، ایجادکنندة بیماری سپتوریوز برگی گندم است یکی از مهم‌ترین بیماری‌های برگی گندم گسترش‌یافته در بسیاری از مناطق دنیا است که در اروپا در درجة اول اهمیت قرار دارد (Thomas et al., 2003). میزان کاهش محصول در آلودگی‌های شدید با این قارچ، 31 تا 53 درصد گزارش شده است.(Eyal, 1981; Eyal and Ziv, 1974)  استفاده از ارقام مقاوم و سموم قارچ‌کش روش‌های موجود برای کنترل این بیماری در گندم هستند (Adhikari et al., 2007). استفاده از ارقام مقاوم ازلحاظ اقتصادی و زیست‌محیطی روش مطمئن‌تری است (Eyal., 1981). مقاومت ژنتیکی در ارقام مختلف به دو صورت کمی و کیفی انجام می‌شود. تاکنون 18 ژن اصلی مقاومت به بیماری (Septoria Tritici Blotch (STB)) نقشه‌یابی شده‌اند که بین آنها Stb1 در آمریکای مرکزی بیشترین پایداری را دارد (Adhikari et al., 2004)؛ درحالی‌که Stb4 که 15 سال پیش در کالیفرنیا مقاومت خیلی خوبی در گندم‌ها باعث شده بود به‌تازگی مقاومت آن شکسته شده است (Jackson et al., 2000). بررسی‌های انجام‌شده برای شناسایی ژن‌های مؤثر در ایجاد مقاومت به سپتوریوز برگی با روش cDNA-AFLP نشان داده‌اند علاوه‌بر این نوع مقاومت اختصاصی یا تک‌ژنی، در مدت پاسخ مقاومت گیاه به این بیماری تظاهر تعداد زیادی از ژن‌ها افزایش می‌یابد (Adhikari et al., 2007). تفاوت در الگوی بیان این ژن‌ها در ارقام مقاوم و حساس پس از آلودگی با قارچ M. graminicola ممکن است نقش اصلی را در سازوکارهای مقاومت در گندم داشته باشد. برای نمونه Sedaghatfar و همکاران (2012) در پژوهشی با روش cDNA-AFLP چندین قطعة مرتبط با مقاومت به بیماری لکة ‌برگی سپتوریایی (STB) دو رقم فلات (Seri 82) و فرونتانه (Frontana) را جدا کردند که قطعات چندشکلی (polymorphism) در مسیرهای مختلف بیوشیمایی نقش داشتند. نتایج حاصل از Real-Time PCR نشان دادند برخی ژن‌ها در زمان‌های ارزیابی‌شده، بیان مختلفی در ارقام حساس و مقاوم نشان می‌دهند. در سال‌های گذشته به‌دلیل بروز برخی مشکلات و تهدیدهای ناشی از مصرف سموم شیمیایی در کشاورزی، گرایش زیادی به استفاده از توانایی بالقوة مواد زیستی در کنترل آفات، بیماری‌ها و علف‌های هرز ایجاد شده است. گیاهان دارویی به‌دلیل داشتن طیف وسیعی از ترکیبات زیستی فعال منبع بالقوة داروهای گیاهی جدید (یا شیمی درمانی) هستند؛ زیرا داروهای گیاهی به‌علت داشتن منشأ طبیعی نسبت به داروهای شیمیایی، سازگاری بیشتری با موجودات زنده دارند و عوارض جانبی کمتری ایجاد می‌کنند. Behdad و همکاران (2013) خاصیت ضدقارچی چند گیاه دارویی ازجمله آویشن شیرازی را علیه قارچ Rhizopus stolonifera، عامل پوسیدگی نرم روی میوة توت‌فرنگی، بررسی کردند. براساس نتایج آنها کاربرد اسانس آویشن شیرازی در غلظت 500 پی‌پی‌ام اثر مهارکننده در رشد میسلیوم قارچ R. stolonifera داشت. Salehzadeh و همکاران (2018) اثر عصارة آویشن را در کنترل و بازدارندگی پمپ ژن NorA در 10 نمونة بیمارستانی بررسی کردند و نشان دادند ژن NorA در همة نمونه‌ها وجود دارد و عصارة آویشن اثر بازدارندگی در بیان ژن در همة نمونه‌های دارای ژن یادشده نشان داد. بررسی Karisto و همکاران (2018) نشان داد علاوه‌بر رشد پیکنیدها در ارقام مختلف که در پژوهش‌های قبلی برای تعیین حساسیت یا مقاومت ارقام استفاده می‌شد باید به‌طور هم‌زمان به رشد و تکثیر قارچ در میزبان هم توجه شود. Perello و Slusarenko (2013) برای توسعة کشاورزی ارگانیک سازگار نشان دادند استفاده از آب سیر تا اندازه‌ای در کنترل پاتوژن‌های قارچی مؤثر است. با‌توجه‌به بررسی تأثیر هفت عصارة گیاه دارویی مختلف در کنترل قارچ سپتوریوز برگی در شرایط آزمایشگاهی نتایج نشان دادند عصارة مرزنجوش بهترین گزینه برای کنترل رشد قارچ در محیط پتری‌دیش است (داده‌ها نشان داده نشده‌اند)؛ بنابراین پژوهش حاضر با هدف بررسی اینکه آیا عصارة این گیاه دارویی، مقاومت گیاهان حساس را به قارچ M. graminicola افزایش می‌دهد و نیز بررسی تأثیر عصارة گیاه دارویی مرزنجوش در القای بیان برخی ژن‌های مقاومت به بیماری سپتوریوز برگی گندم در دو رقم حساس (یاواروس) و مقاوم (چمران) انجام شد.

 

مواد و روش‌ها

عصاره‌گیری نمونه‌های گیاهی: در پژوهش حاضر، عصارة گیاه دارویی مرزنجوش با روش خیساندن بامتانول 70 درصد و با دستگاه هم‌زن برقی (مدل Si 100 R، شرکت Honyang، کرة جنوبی) و پمپ خلاء (مدل FTVO-501، شرکت Sci Finetech، کرة جنوبی) استخراج شد. در پایان برای جداسازی حلال آلی از عصاره‌ها، از دستگاه روتاری (مدل RV05 BASIC، شرکت IKA-WERKE، ژاپن) استفاده شد. تأثیر هفت عصارة گیاه دارویی مختلف در بازدارندگی رشد با قارچ سپتوریوز در شرایط آزمایشگاهی بررسی شد. نتایج نشان دادند عصارة مرزنجوش تأثیر بهتری در کنترل رشد قارچ در شرایط آزمایشگاهی داشت؛ بنابراین آزمایش اصلی بررسی تأثیر عصارة مرزنجوش در القای مقاومت برخی ژن‌های دخیل در مقاومت به بیماری سپتوریوز برگی گندم در دو رقم حساس و مقاوم در مرحلة گیاهچه‌ای بود.

آلودگی نمونه‌ها و اعمال تیمار:دو رقم گندم چمران و یاواروس که به‌ترتیب مقاوم و حساس به بیماری سپتوریوز برگی گندم‌اند، در گلخانه در دو شرایط کنترل و تیمار کشت شدند و وقتی‌که به مرحلة دوبرگی رسیدند، نیمی از گیاهان با عصارة گیاه دارویی مرزنجوش با اسپری دستی عصاره‌پاشی (تلقیح) شدند. دو روز پس از تیمار نمونه‌ها با عصاره، دو رقم با ایزولة قارچ سپتوریوز دهلران جلیزی آلوده شدند که کارشناسان سازمان جهاد کشاورزی ایلام جمع‌آوری کرده بودند. غلظت اسپورها با لام هموسایتومتر (Neubar، شرکت Marienfeld، آلمان) در زیر میکروسکوپ (مدل H 730، شرکت Nedic، آلمان) تعیین شد. غلظت نهایی برای اسپورپاش 105 ´7 اسپور در میلی‌لیتر در نظر گرفته شد (Kema et al., 1996). پس از اینکه سوسپانسیون قارچ به غلظت مد نظر رسانده شد، به هر لیتر از سوسپانسیون، 10 قطره توین 20 اضافه شد که به چسبندگی اسپورها و باقی‌ماندن آنها روی برگ هنگام اسپورپاشی منجر می‎شود. اسپورپاشی با اسپری دستی انجام شد. پس از اسپور‌پاشی، گیاهان در اتاقک رشد در دمای 22 درجة سانتی‌گراد و رطوبت نسبی 90 درصد در تاریکی قرار داده شدند. نمونه‌برداری در زمان‌های 6، 12 و 24 ساعت پس از آلودگی در دو شرایط کنترل و تیمار و هرکدام در سه تکرار انجام شد. نمونه‌های برگی جمع‌آوری‌شده بلافاصله به ازت مایع برای استخراج RNA و سایر آنالیز‌های بعدی منتقل شدند.

استخراج RNA و سنتز cDNA: استخراج RNA از نمونه‌های برگی با کیت استخراج Cinnapure RNA (PR891620، شرکت سیناژن، ایران) انجام شد. تعیین کمیت RNA استخراج‌شده، با روش اسپکتروفتومتری انجام و برای تعیین کیفیت نمونه‌ها از روش الکتروفورز ژل آگارز یک درصد استفاده شد. سنتز رشتة اول cDNA با کیت (2-steps RT-PCR، شرکت سیناکلون، ایران) طبق مراحل زیر انجام شد. ابتدا برای سنتز رشتة‌ اول cDNA، مخلوطی شامل 1 میکرولیتر Oligo dT (آغازگر)، 1 میکرولیتر dNTPs، 3 میکرولیتر RNA و 5 میکرولیتر آب بدون نوکلئاز (Nuclease free Water) افزوده شد (حجم نهایی 10 میکرولیتر بود.). تیوب‌های 2/0 (شرکت سینا کلون، ایران) به‌مدت 5 دقیقه در دمای 65 درجة سانتی‌گراد در دستگاه بن‌ماری یا حمام آب گرم (مدل S 100، Honyang، کرة جنوبی) و سپس به‌مدت 2 دقیقه روی یخ قرار داده شدند. پس از آن، نمونه‌ها به‌آرامی تکان داده شدند؛ سپس به رشتة اول ساخته‌شدة cDNA، 2 میکرولیتر بافر 10 x Buffer M-Mul V، 1 میکرولیتر آنزیم رونوشت بردار معکوس M-Mul V Reverse Transcriptase و 7 میکرولیتر آب بدون نوکلئاز افزوده شد (جدول 1)؛ سپس 10 میکرولیتر از ترکیب یادشده به تیوب‌ها اضافه شد و تیوب‌ها در بن‌ماری به‌مدت 60 دقیقه در دمای 42 درجة سانتی‌گراد و درنهایت، به‌مدت 5 دقیقه در دمای 85 درجة سانتی‌گراد قرار داده شدند؛ سپس به‌مدت 2 دقیقه روی یخ قرار گرفتند. پس از آن به‌مدت 2 دقیقه با سرعت 10000 دور بر دقیقه و در دمای اتاق سانتریفیوژ (مدل 3-30 K، شرکت Sigma، آلمان) و به فریزر 80- (مدل ALS، شرکت Angelantoni، ایتالیا) منتقل شدند.

 

جدول 1- مواد استفاده‌شده برای سنتز رشتة اول cDNA

مقدار

ماده

2 میکرو لیتر

x Buffer M-Mul V 10

100 واحد یا

1 میکرولیتر

M-Mul V Reverse Transcriptase

7 میکرولیتر

Nuclease- free Water

10 میکرولیتر

حجم نهایی واکنش

کیفیت نمونه‌ها با الکتروفورز در ژل آگارز یک درصد (وزنی - حجمی) ارزیابی شد.

اندازه‌گیری بیان ژن: از واکنش Real-time PCR (RT-PCR) نیمه‌کمی برای آنالیز الگوی بیان دو ژن مرتبط با دفاع، در دورة یک‌روزه پس از آلودگی استفاده شد. ارزیابی کمی در واکنش RT-PCR با کیت (qPCR GreenMaster with lowRox، شرکت تکاپو زیست، ایران) انجام شد. برای انجام واکنش RT-PCR از 100 نانوگرم cDNA سنتزشده، آغازگرهای اختصاصی مربوط به ژن‌های بررسی‌شده و ژن اکتین برای کنترل داخلی استفاده شد (جدول 2).

 

 

جدول 2- آغازگرهای طراحی‌‌شده برای واکنش Real time PCR

نام آغازگر

توالی

تعداد نوکلئوتید

دمای اتصال

طول قطعه

اکتین

Actin-F: 5TCCTAACCGAGCGAGGCTTCAT 3

Actin R: 5 GGAAAAGCACTTCTGGGCACC3

22

21

56

151

 

pr1

PR 1- F: 5 TAATCTTTCCCAGGCGCAG 3

PR 1- R: 5 GTTGGAGTCGTAGTCGTAG 3

25

25

52

120

 

ppi

PPi-F: 5 GAGATCGACCCGGACAACAG 3

PPi -R: 5 CTCCGTCTTCCTCCATTTGG 3

26

26

60

126

 

پرایمرهای مربوط به ژن‌های pr1 و ppi برگرفته از پژوهش Adhikari و همکاران (2007) هستند.

 

 

برای آنالیز بیان ژن با روش RT-PCR از روش مبتنی بر رنگ فلورسنس SYBR green در دو تکرار دستگاهی و سه تکرار زیستی استفاده شد. در این روش برای انجام واکنش RT-PCR از پلیت 48 چاهکی ویژة دستگاه Real Time PCR (مدل Step One Plus، شرکت ABI، آمریکا) با حجم واکنش نهایی20 میکرولیتر شامل مواد بیان‌شده در جدول 3 استفاده شد. برنامة دمایی به‌کاررفته شامل فعال‌‌کردن آنزیم در دمای 95 درجة سانتی‌گراد به‌مدت 10 دقیقه و چرخة 40 تایی شامل دمای واسرشت 95 درجة سانتی‌گراد به‌مدت 15 ثانیه، دماهای اتصال آغازگر به رشتة الگو، 53 و 60 درجة سانتی‌گراد به‌مدت 30 ثانیه و 72 درجة سانتی‌گراد به‌مدت 1 دقیقه بودند. درنهایت، آزمون نقطة ذوب در یک چرخة دمایی شامل دمای 95 درجة سانتی‌گراد به‌مدت 15 ثانیه، دمای 60 درجة سانتی‌گراد به‌مدت 1 دقیقه و افزایش 3/0 درجه‌ای تا دمای 95 درجة سانتی‌گراد برای ترسیم نمودار ذوب محصول PCR انجام شد.

 

جدول 3- مواد شیمیایی و مقادیر استفاده‌شده در واکنش Real Time PCR

مادة شیمیایی

مقدار استفاده‌شده

غلظت نهایی

Cdna

100 نانوگرم

 

qPCR GreenMaster with lowRox

10 میکرولیتر

1X

Primer F

8/0 میکرولیتر

5/0میکرومول

Primer R

8/0 میکرولیتر

5/0میکرومول

RNase free H2O

تا 20 میکرولیتر

 

         

 

 

تحلیل داده‌های RT-PCR و بررسی بیان نسبی هر ژن براساس روش نمودار استاندارد نسبی (relative standard curve method) برپایة رابطة 1 (Livak and Schmittgen, 2001) و با نرم‌افزار محاسباتی شرکت Bio Rad و نیز با نرم‌افزار Excel نسخة 2007 انجام شد.

رابطة 1

مقدار بیان ژن =

2-(CT Gene-CT Ref) Stress–(mean CT gene– mean CT Ref) Normal

مطابق با این رابطه مقدار ژن (cDNA حاصل از رونوشت) برابر با 2 به توان منفی تفاوت آستانة سیکل (Cycle Threshold=CT) ژن هدف در تنش و ژن مرجع متناظر آن منهای تفاوت میانگین‌های آستانة سیکل ژن هدف بدون تنش و ژن مرجع متناظر آن است. پایة 2 به‌دلیل دوبرابرشدن مقدار cDNA در هر چرخة PCR است.

تحلیل آماری:تحلیل داده‌ها و مقایسة میانگین‌ها با روش LSD و با نرم‌افزار SAS نسخة 1/9 در سطح احتمال 5 درصد انجام شدند.

 

نتایج

کمیت RNA استخراج‌شده روی ژل آگارز یک درصد و وجود دو باند 18S و 28S بدون خردشدگی‌ نشان‌دهندة کیفیت مناسب RNA استخراج‌شده است (شکل 1).

 

 

 

شکل 1- RNA استخراج‌شده روی ژل آگارز- دو باند 28S و 18S در برخی نمونه‌های بررسی‌شده تشکیل شدند.


بررسی بیان ژن‌های pr1 و ppi در شرایط طبیعی و تنش: مقدار بیان اندازه‌گیری‌شدة هر ژن با دستگاه در زمان واقعی ثبت و تحلیل می‌شوند. ژن خانه‌دار اکیتن در زمان‌های مختلف در دو نمونة بررسی‌شده مقدار CT تقریباً یکسانی را نشان دادند که بین می‌کند شرایط محیطی بر بیان ژن‌های خانه‌دار تأثیر نمی‌گذارند؛ درحالی‌که دستگاه اندازه‌گیری، مقدار CT را برای ژن‌های کارکردی در زمان‌های مختلف، بسیار متفاوت نشان داد.

همان‌طور‌که در شکل 2 مشاهده می‌شود میزان بیان ژن pr1 در زمان‌های مختلف بین دو رقم مقاوم و حساس پس از عصاره‌پاشی و آلودگی با ایزولة قارچ، بسیار متفاوت است؛ به‌طوری‌که 6 ساعت پس از اعمال تیمار در رقم حساس و مقاوم میزان بیان ژن pr1 نسبت به سایر زمان‏ها به اوج خود رسید و مقدار بیان ژن pr1 در رقم مقاوم دو برابر بیشتر از رقم حساس بود. علاوه‌براین، میزان بیان ژن pr1، 12 ساعت پس از اعمال تیمار در رقم چمران 5/2 برابر بیشتر از رقم یاواروس بود. اگرچه میزان بیان ژن pr1 نسبت به زمان 6 ساعت پس از اعمال تیمار کاهش یافت، 24 ساعت پس از اعمال تیمار، میزان بیان این ژن در رقم حساس به بیشترین مقدار رسید و در رقم مقاوم و حساس تقریباً برابر بود. میزان بیان ژن pr1 در رقم حساس روند کاهشی - افزایشی و در رقم مقاوم روند افزایش - کاهش را در زمان‌های بررسی‌شده نشان می‏دهد.

ژن ppi نیز CT‌های متفاوتی در زمان‌های مختلف و ارقام متفاوت نشان داد که بیان‌کنندة میزان بیان متفاوت این ژن در دو رقم حساس و مقاوم در زمان‏های مختلف است. با‌توجه‌به شکل 3 در زمان 6 ساعت پس از اعمال تیمار، میزان بیان ژن ppi در رقم یاواروس تقریباً 5/2 برابر رقم

 

 

 

شکل 2- بررسی بیان ژن pr1 در دو رقم یاواروس و چمران در زمان‌های مختلف پس از تلقیح- مقادیر، میانگین سه تکرار ± انحراف‌معیار هستند. حروف متفاوت، بیان‌کنندة تفاوت معنی‌دار در سطح 05/0P≤ با آزمون LSD هستند.

 

چمران بود؛ درحالی‌که در زمان 12 ساعت میزان بیان ژن Ppi در هر دو رقم حساس و مقاوم کاهش یافت؛ ولی میزان بیان آن در رقم چمران 9 برابر بیشتر از رقم یاواروس بود. 24 ساعت پس از اعمال تیمار، میزان بیان ژن ppi در رقم یاواروس دوباره افزایش یافت و9 برابر بیشتر از رقم چمران شد‏ و در رقم چمران میزان بیان این ژن کاهش یافت. به‌طورکلی میزان بیان ژن ppi در رقم حساس روند کاهشی - افزایشی ولی در رقم مقاوم روند کاهشی داشت و بجز زمان 12 ساعت، میزان بیان ژن ppi در رقم یاواروس بیشتر از رقم چمران مشاهده شد.

 

 

 

شکل 3- بررسی بیان ژن ppi در دو رقم یاواروس و چمران در زمان‌های مختلف پس از تلقیح- مقادیر، میانگین سه تکرار ± انحراف‌معیار هستند. حروف متفاوت، بیان‌کنندة تفاوت معنی‌دار در سطح 05/0P≤ با آزمون LSD هستند.

 


بحث

مصرف عصارة گیاهان دارویی علاوه‌براینکه کاربرد آسان در کنترل بیماری‏های گیاهی دارد، کاهش هزینه‏های کنترل و جلوگیری از از بین رفتن تعادل بوم‌شناختی محیط را باعث می‏شود (Joseph et al., 2008). ترکیبات شیمیایی مرزنجوش شامل اسانس، تانن، رزین، استرول و فلاونوئید هستند (Zargari, 1996). این ترکیبات معمولاً اختلال در غشای سیتوپلاسمی، شکستن و از هم گسیختن نیروی حرکتی پروتون، جریان الکترونی و انتقال فعال و انعقاد و گلوله‌شدن محتویات سلولی را موجب می‌شوند (Caillet and Lacroix., 2006; Caillet et al., 2005).

 Antoniwو همکاران (1980) اصطلاح پروتئین‌های مرتبط با پاتوژن را مطرح و اعلام کردند پروتئین‌هایی هستند که گیاه آنها رمز‌گذاری می‌کند؛ اما تنها در شرایط پاتولوژیک یا شرایط مشابه بیان می‌شوند که بیان‌کنندة منشاء غیر پاتولوژنیک این پروتئین‌ها است. PR1 با پروتئین‌های مشابه توماتین (Thaumatin) فعالیت ضدقارچی را در مجموعه‌ای از قارچ‌های بیماری‌زا و غیربیماری‌زا نشان می‌دهد (Niderman et al., 1995). پروتئین‌های مرتبط با عامل بیماری‌زا با مقاومت به بیماری در تقابل گیاه - پاتوژن در غلات ارتباط دارند (Buchel and Linthorst, 1999; Van Loon and Van Strien, 1999). پروتئین‌هایی مانند PR2 (بتا 1 و 3 گلوکوناز) و PR3 (کیتیناز) فعالیت‌های ضد قارچی دارند و دیوارة سلولی را تجزیه می‌کنند یا مستقیماً از رشد پاتوژن جلوگیری می‌کنند (Takeuchi et al., 1990; Wu et al., 1997; Jia and Martin, 1999) و به‌صورت PAPMs/MAMPs عمل می‌کنند (Nurnberger et al., 2004; Altenbach and Robatzek., 2007). پس از حملة عامل بیماری‌زا گیاهان، تعدادی از سازوکارهای دفاعی شامل اکسیداسیون، تغییرات دیوارة سلولی و تولید اجزاء مرتبط با دفاع مانند PRها وکیتینازها (Bolwell, 1999; Kini et al., 2000; Shetty et al., 2008) را انجام می‌دهند. این پروتئین‌ها دیوارة سلولی قارچ را تجزیه و از رشد آن جلوگیری می‌کنند (Kim and Hwang., 1997).

Shetty و همکاران (2009) همة پروتئین‌های مرتبط با عامل بیماری‌زا وکیتیناز‌ها را در برگ‌های گندم آلوده به S. triticiبررسی کردند و نتایج آنها نشان دادند مقاومت با تجمع اولیة بتا 1 و 3 گلوکوناز و کیتیناز در برگ‌ها مرتبط است و براساس نتایج آنها گلیکوپرتئین‌هایی مانند اکتنسین به آپوپلاست آزاد می‌شوند و تجمع کالوز به تقویت دیوارة سلولی منجر می‌شود. نتیجة کلی پژوهش‌های آنها نشان داد مقاومت با تشخیص سریع و اولیة پاتوژن با بتا 1 و 3 گلوکان در دیوارة سلولی قارچ ارتباط دارد و به تجمع بتا 1 و 3 گلوکوناز و واکنش‌های ساختاری دفاعی منجر می‌شود که به‌طور مستقیم از رشد عامل بیماری‌زا جلوگیری و از میزبان در مقابل آنزیم‌های قارچ و مواد سمی محافظت می‌کند. ژن‌های pr1 در مراحل نخست آلودگی القاء می‌شوند. ژن‌های pr به‌شدت در سه ساعت اول پس از آلوده‌کردن در ارقام مقاوم به M. graminicola القاء می‌شوند.

Ray و همکاران (2003) برپایة بررسی الگوی بیان ژن در مدت چهار روز اول پس از آلوده‌‌کردن نشان دادند سه پروتئین وابسته به بیماری‌زایی (PR) به ‌نام‌های PR-1، PR-2 و PR-5 در برگ‌های گیاهان آلوده، سه تا دوازده ساعت پس از آلودگی القاء شده‌اند. Adhikari و همکاران (2007) نشان دادند بیان ژن pr1، 12 تا 24 ساعت پس از تلقیح به بیشترین مقدار می‌رسد. Fazeli (2012) نشان داد بیان ژن pr1 در واکنش به قارچ M. graminicola در هر دو رقم مقاوم و حساس افزایش یافت و 12 ساعت پس از تلقیح، میزان بیان آن در رقم مقاوم به‌طور مشخص 5 برابر بیشتر از رقم حساس بود. براساس پژوهش‌هایی که بر ارقام مقاوم گندم انجام شدند Ray و همکاران (2003) این نظریه را مطرح کردند که تغییرات ایجادشده در بیان ژن‌ها در مدت دوازده تا بیست و چهار ساعت نخست آلودگی، پیروزی یا شکست میزبان را تعیین می‌کنند. پس از آن مشخص شد این. نظریه دربارة همة ژن‌ها صدق نمی‌کند؛ سپس این نظریه مطرح شد که دفاع میزبان دو پیک القای ژنی دارد که پیک اول در دوازده تا بیست و چهار ساعت اولیة آلودگی ایجاد می‌شود و پیک دوم که خیلی قوی‌تر القاء می‌شود، دوازده تا هجده روز پس از آلوده‌کردن شروع می‌شود. همچنین پژوهش‌ها نشان دادند القای بیان این ژن‌ها در ارقام حساس در زمان مشابه نسبت به ارقام مقاوم بسیار ناچیز‌تر است. Adhikari و همکاران (2004) نشان دادند پیک دوم القای بیان ژن در ارقام مقاوم دقیقاً زمانی اتفاق می‌افتد که در ارقام حساس، تودة قارچی به‌سرعت در حال رشد است؛ بنابراین تغییر رشد عامل بیماری‌زا از بیوتروفیک به نکروتروفیک در ارقام مقاوم تشخیص داده شد که پاسخی قوی و موفق را باعث می‌شود. براساس بررسی‌ها نتیجه‌گیری می‌شود پاشیدن عصارة گیاه دارویی مرزنجوش مقاومت را در رقم حساس، 24 ساعت پس از آلودگی افزایش می‌دهد و به القای سیستم دفاعی گیاه در مقابل عامل بیماری‌زا کمک شایان توجهی می‌کند.

FKBP‌ها یا پروتئین‌های پپتیدیل پرولیل ایزومراز (PPI) بازدارندة ایمنی، از قارچ‌ها مشتق می‌شوند که از طریق اتصال به FK506 و راپامایسین عمل می‏کنند (Park et al., 2007). سایکلوفیلین‌های گیاهی با تنش‌های ناشی از عوامل زنده و غیرزنده القاء می‏شوند (Godoy et al., 2000). سایکلوفیلین‌های گیاهی فعالیت ضد قارچی دارند (Lee et al., 2007). Ray و همکاران (2003) نشان دادند بیشتر ژن‌های مرتبط با دفاع در دو رقم مقاوم تادیانا (Tadiana) و W7984 پس از آلودگی با سیگنالیگ، متابولیسم انرژی و سنتز پروتئین‌ها همراه هستند. بیان بیشتر ژن ppi در ارقام مقاوم نسبت به ارقام حساس نشان می‌دهد تولید انرژی و مسیر سیگنالینگ هورمون‌ها در ارقام مقاوم نسبت به ارقام حساس بیشتر فعال هستند. Adhikari و همکاران (2004) نشان دادند فعالیت این ژن در ارقام مقاوم، زمانی است که زیتودة قارچ به‌طور لگاریتمی در ارقام حساس افزایش می‌یابد. Fazeli (2012) نشان داد میزان بیان ژن ppi در رقم فلات در زمان‌های انتهایی یعنی 6 روز پس از آلودگی بود که این میزان بیان در 6 روز پس از آلودگی افزایش یافت و به بیشترین میزان یعنی 2 برابر نسبت به شاهد رسید. در رقم مقاوم فرونتانا (Frontana) میزان بیان ژن ppi نسبت به شاهد افزایش چشمگیری نشان نداشت و تنها 24 ساعت پس از آلودگی، فزایش بیان دو برابری داشت. نتیجه‌گیری می‌شود با به کار بردن عصارة متانولی مرزنجوش، بیان ژن ppi در رقم حساس، 24 ساعت پس از آلودگی نسبت به رقم مقاوم بیشتر می‌شود و افزایش مقاومت رقم حساس را باعث می‌شود. نتایج پژوهش Moridikia و همکاران (2016) بر اثر ضد میکروبی عصارة هیدروالکلی مرزة سفید و نانو ذرة روی اکسید در بیان ژن کواگولاز (coa) در نمونه‌های بالینی و استاندارد Staphylococcus aureus مقاوم به پنی‌سیلین با روش RT-PCR نشان دادند عصارة هیدروالکلی مرزة سفید بیان ژن coa را در شرایط آزمایشگاهی کاهش داد؛ ولی تأثیری در بیان ژن خانه‌دار arcC نداشت. Jalalvandi و همکاران (2015) اثر مهاری مرزة خوزستانی را در ژن‌های اگزوآنزیم s، اگزوتوکسین A و سیستم‌های ترشحی و خارج‌کنندة پمپ‌های آنتی‌بیوتیک pseudomonas aeruginosa با روش RT-PCR نیمه‌کمی بررسی و مشخص کردند این گیاه اثر مهاری در ژن‌های یادشده دارد که با نتایج به‌دست‌آمده از پژوهش حاضر مطابقت دارد؛ زیرا گیاهان تیرة نعناعیان (Lamiaceae) به‌دلیل داشتن ترکیبات شیمیایی تیمول و کارواکرول خاصیت ضدقارچی دارند. در پژوهش Kim و همکاران (2013) مشخص شد کارواکرول بیان ژن‌های lxra، fas leptin و srebp1c را کاهش می‌دهد و ازسویی افزایش بیان ژن sirt1 را باعث می‌شود؛ بنابراین کارواکرول بیان ژن‌های دخیل در متابولیسم چربی‌ها را تعدیل و تنظیم می‌کند که با نتایج پژوهش حاضر مطابقت دارد.

 

جمع‌بندی

خسارت اقتصادی ناشی از M. graminicolla در جهان نیازمند روش‌های مؤثر در کنترل این بیماری است. استفاده از قارچ‌کش‌ها و ارقام مقاوم که مقاومت جزئی به بیماری سپتوریای برگی دارند، درحال‌حاضر روشی رایج در کنترل این بیماری است. کاربرد عصارة گیاهان دارویی یکی از منابع خوب برای مدیریت و کنترل بیماری‌ها در آینده است. گیاه مرزنجوش به‌دلیل داشتن ترکیبات کارواکرول گزینة خوبی برای بررسی‌های بیشتر دربارة شیوة کنترل بیماری سپتوریوز است. به کار بردن عصارة مرزنجوش افزایش بیان ژن pr1 را در رقم مقاوم و افزایش بیان ژن ppi را در رقم حساس باعث شد. باتوجه‌به آثار کلی بیان ژن در دو رقم حساس و مقاوم نتیجه‌گیری می‌شود به کار بردن عصارة گیاه دارویی فعال‌شدن سیستم دفاعی گیاه را در مقابل پاتوژن باعث می‌شود؛ به‌طوری‌که بیان ژن ppi، 24 ساعت پس از آلودگی در رقم حساس خیلی بیشتر از رقم مقاوم می‌شود. همچنین نتایج پژوهش حاضر نشان می‌دهند باتوجه‌به وجود ترکیب شیمیایی کارواکرول در مرزنجوش به نظر می‌رسد این ترکیب افزایش بیان ژن‌های استفاده‌شده را در پژوهش حاضر موجب می‌شود.

 

سپاسگزاری

نگارندگان از معاونت محترم پژوهشی دانشگاه ایلام برای حمایت مالی از پژوهش حاضر و کارشناسان آزمایشگاه بیوتکنولوژی دانشکدة کشاورزی دانشگاه ایلام سپاسگزاری می‌کنند.

 

Adhikari, T. B., Balaji, B., Breeden, J. and Goodwin, S. B. (2007) Resistance of wheat to Mycosphaerella graminicola involves early and late peaks of gene expression. Physiological and Molecular Plant Pathology 71(1-3): 55-68.

Adhikari, T. B., Yang, X., Cavaletto, J. R., Hu, X., Buechley, G., Ohm, H. W., Shaner, G. and Goodwin, S. B. (2004) Molecular mapping of Stb1, a potentially durable gene for resistance to septoria tritici blotch in wheat. Theoretical and Applied Genetics 109(5): 944‐953.

Altenbach, D. and Robatzek, S. (2007) Pattern recognition receptors: from the cell surface to intracellular dynamics. Molecular Plant-Microbe Interactions 20(9): 1031-1039.

Antoniw, J. F., Ritter, C. E., Pierpoint, W. S. and Van Loon, L. C. (1980) Comparison of three pathogenesis-related proteins from plants of two cultivars of tobacco infected with TMV. Journal of General Virology 47(1): 79-87.‏

Behdad, M., Etemadi, N. A., Behdad, E. and Zeinali, H. (2013) Antifungal effects of three plant essential oils against Rhizopus stolonifer, the cause of soft rot on strawberry fruit. Iranian Journal of Medicinal and Aromatic Plants 29(2): 399-411 (in Persian).

Bolwell, G. P. (1999) Role of active oxygen species and NO in plant defense. Current Opinion in Plant Biology 2(4): 287-294.

 

Buchel, A. S. and Linthorst, H. J. M. (1999) PR-1: A group of plant proteins induced upon pathogen infection. In: Pathogenesis-related proteins in plants (Eds. Datta, S. K. and Muthukrishnan, S.) 21-47. CRC Press LLC, Boca Raton.

Caillet, S. and Lacroix, M. (2006). Effect of gamma radiation and oregano essential oil on murein and ATP concentration of Listeria monocytogenes. Journal of Food Protection 69(12): 2961-2969.

Caillet, S., Shareck, F. and Lacroix, M. (2005) Effect of gamma radiation and oregano essential oil on murein and ATP concentration of Escherichia coli O157: H7. Journal of Food Protection 68(12): 2571-2579.

Eyal, Z. (1981) Integrated control of Septoria diseases of wheat. Plant Disease 65(9): 763-768.

Eyal, Z. and Ziv, O. (1974) The relationship between epidemics of Septoria leaf blotch and yield losses in spring wheat. Phytopathology 64(11): 1385-1389.

Fazeli, A. (2012) Transcriptional responses of wheat to Septoria tritici disease using microarray technique. PhD Thesis, Mazandaran university, Mazandaran, Iran (in Persian).

Godoy, V. A., Lazzaro, A. S., Casalongue, C. A. and San-Segundo, B. (2000) Expression of a Solanum tuberosum cyclophilin gene is regulated by fungal infection and abiotic stress conditions. Plant Science 152(2): 123-134.

Goutam, U., Kukreja, S., Tiwari, R., Chaudhary, A., Gupta, R. K., Dholakia, B. B. and Yadav, R. (2013) Biotechnological approaches for grain quality improvement in wheat: present status and future possibilities. Australian Journal of Crop Science 7(4): 469-483.

Jackson, L. F., Dubcovsky, J., Gallagher, L. W., Wennig, R. L., Heaton, J. and Vogt, H. (2000) Regional barley and common and durum wheat performance tests in California. Agronmy Progres Report 272(1): 48-56.

Jalalvandi, N., Bahador, A., AZahedi, B., Saghi, H. and Esmaeili, D. (2015) The study of inhibitory effects of satureja khuzestanica essence against mexa and mexr efflux genes of pseudomonas aeruginosa by RT-PCR. International Journal of Biotechnology 4(1): 1-8.

Jia, Y. and Martin, G. B. (1999) Rapid transcript accumulation of pathogenesis-related genes during an incompatible interaction in bacterial speck disease-resistant tomato plants. Plant Molecular Biology 40(3): 455-465.

Joseph, B., Dar, M. A. and Kumar, V. (2008) Bioefficacy of plant extracts to control Fusarium solani F. sp. melongenae incitant of brinjal wilt. Global Journal of Biotechnology and Biochemistry 3(2): 56-59.

Karisto, P., Hund, A., Yu, K., Andregg, J., Walter, A., Mascher, F., McDonald, B. A. and Mikaberidze, A. (2018) Ranking quantitative resistance to Septoria tritici blotch in Elite Wheat Cultivars Using Automated Image Analysis. Phytopathology 108(5): 568-581.

Kema, G. H. J., Yu, D. Z., Rijkenberg, F. H. J., Shaw, M. W., Baayen and R. P. (1996) Histology of the pathogenesis of Mycosphaerella graminicola in wheat. Phytopathology 86(4): 777-786.

Kim, E., Choi, Y., Jang, J. and Park, T. (2013) Carvacrol protects against Hepatic steatosis in mice fed a high-fat diet by enhancing SIRT1-AMPK signaling. Evidence-Based Complementary and Alternative Medicine 50(2): 103-115.

Kim, Y. J. and Hwang, B. K. (1997) Isolation of a basic 34 kilo Dalton b-1,3- glucanase with inhibitory activity against Phytophthora capsici from pepper stems. Physiological and Molecular Plant Pathology 50(2):103-115.

Kini, K. R., Vasanthi, N. S. and Shetty, H. S. (2000) Induction of b-1,3-glucanase in seedlings of pearl millet in response to infection by Sclerospora graminicola. European Journal of Plant Pathology 106(3): 267-274.

Kiss, T., Balla, K., Veisz, O., Lang, L., Bedo, Z., Griffiths, S., Isaac, P. and Karsai, I. (2014) Allele frequencies in the VRN-A1, VRN-B1 and VRN-D1 vernalization response and PPD-B1 and PPD-D1 photoperiod sensitivity genes and their effects on heading in a diverse set of wheat cultivars (Triticum aestivum L.). Molecular Breeding 34: 297-310.

Lee, S. O., Choi, G. J., Jang, K. S, Lim, H. K., Cho, K. Y. and Kim, J. C. (2007) Antifungal activity of five plant essential oils as fumigant against postharvest and soilborne plant pathogenic fungi. Plant Pathology Journal 23(2): 97-102.

Moridikia, F., Khosrovani, S., Ghaedi, M., Zoladl, M., Moridikia, A., Mohseni, R., Alamdari, A. K. and Sharifi, A. (2016) The antimicrobial effect of Satureja mutica hydroalcoholic extract, zinc oxide nanoparticle, and zinc complex on the coagulase gene expression in clinical and standard isolates of methicillin-resistant Staphylococcus aureus (MRSA). Armaghane-Danesh 21(3): 305-313 (in Persian).

Niderman, T., Genetet, I., Bruyère, T., Gees, R., Stintzi, A., Legrand, M., Fritig, B. and Mösinger, E. (1995) Pathogenesis-related PR-1 proteins are antifungal. Isolation and characterization of three 14-kilodalton proteins of tomato and of a basic PR-1 of tobacco with inhibitory activity against Phytophthora infestans. Plant Physiology 108(1): 17-27.

Nurnberger, T., Brunner, F., Kemmerling, B. and Piater, L. (2004) Innate immunity in plants and animals: striking similarities and obvious differences. Immunological Reviews 198(1): 249-266.

Park, S. C., Lee, J. R., Shin, S. O., Jung, J. H., Lee, Y. H., Son, H., Park, Y., Lee, S. Y. and Hahm, K. S. (2007) Purification and characterization of an antifungal protein, C-FKBP, from Chinese cabbage. Journal of Agricultural and Food Chemistry 55(13): 5277-5281.

Perello, A., Noll, U. and Slusarenko, A. J. (2013) In vitro efficacy of garlic extract to control fungal pathogens of wheat. Journal of Medicinal Plants Research Full Length 7(24): 1809-1817.

Ray, S., Anderson, J. M., Urmeev, F. I. and Goodwin, S. B. (2003). Rapid induction of a protein disulfide isomerase and defense-related genes in wheat in response to the hemibiotrophic fungal pathogen Mycosphaerella graminicola. Plant Molecular Biology 53(5): 741-754.‏

Salehzadeh, A., Sadat Hashemi Doulabi, M., Sohrabnia, B. and Jalali, A. (2018) The effect of thyme (Thymus vulgaris) extract on the expression of norA efflux pump gene in clinical strains of Staphylococcus aureus. Journal of Genetic Resources 4(1): 26-36.

Sedaghatfar, E., Zamanizadeh, H. R., Roohparvar, R., Farsad, L. K., Fazeli, A., Rezaee, S. and Mardi, M. (2012) Gene expression profiling of defense-related genes resistant to Septoria tritici blotch in wheat. African Journal of Biotechnology 11(72): 13633-13644.

Shetty, N. P., Jensen, J. D., Knudsen, A., Finnie, C., Geshi, N., Blennow, A., Collinge, D. B. and Jorgensen, H. J. L. (2009) Effects of beta-1,3-glucan from Septoria tritici on structural defense responses in wheat. Journal of Experimental Botany 60(15): 4287-4300.

Shetty, N. P., Jørgensen, H. J. L., Jensen, J. D., Collinge, D. B. and Shetty, H. S. (2008) Roles of reactive oxygen species in interactions between plants and pathogens. European Journal of Plant Pathology 121(3): 267-280.

Singh, R. P., Huerta-Espino, J., Sharma, R., Joshi, A. K. and Trethowan, R. (2007) High yielding spring bread wheat germplasm for global irrigated and rainfed production systems. Euphytica 157(3): 351-363.

Singh, R. P., and Trethowan, R. (2007) Breeding spring bread wheat for irrigated and rainfed production systems of the developing world. In: Breeding major food staples (Eds. Kang, M. and Priyadarshan, P. M.) 109-140. Blackwell Publishing, Iowa.

Takeuchi, Y., Yoshikawa, M., Takeba, G., Tanaka, K., Shibata, D. and Horino, O. (1990) Molecular cloning and ethylene induction of mRNA encoding a phytoalexin elicitor-releasing factor, b-1,3-endoglucanase, in soybean. Plant Physiology 93(2): 673-682.

Thomas, C., Meyer, D., Wolff, M., Himber, C., Alioua, M. and Steinmetz, A. (2003) Molecular characterization and spatial expression of the sunflower ABP1 gene. Plant Molecular Biology 52(5): 1025-1036.