ساختار ژنتیکی مولفه‌های جوانه‌زنی جو تحت شرایط نرمال و تنش شوری

نوع مقاله: مقاله پژوهشی

نویسندگان

1 گروه تولیدات گیاهی، دانشکده کشاورزی، دانشگاه گنبد کاووس، گنبد کاووس، ایران

2 استادیار، بخش تحقیقات زراعی و باغی، مرکز تحقیقات و آموزش کشاورزی و منابع طبیعی مازندران، سازمان تحقیقات آموزش و ترویج کشاورزی، ساری

چکیده

شوری یکی از اصلی‌ترین تنش‌های اسمزی است، که رشد و تولید گیاهان را از طریق تغییر در تعادل یونی و اسمزی محدود می‌کند. به منظور مکان‌یابی نواحی ژنومی کنترل‌کننده صفات کمی (QTLs) مرتبط با تحمل به شوری در جو و ارزیابی صفات مربوط به مرحله جوانه‌زنی، آزمایشی در سال‌های 1395 و 1396 با استفاده از 100 خانواده F3 حاصل از تلاقی بادیا × کومینو به همراه والدین آنها در قالب طرح کاملا تصادفی با سه تکرار و 6 تیمار شامل وضعیت نرمال و پنج سطح شوری (4، 8، 12، 15 و 20 دسی‌زیمنس بر متر) اجرا گردید. تجزیه QTL به روش مکان‌یابی مرکب براساس هر شش تیمار انجام گرفت. در مجموع، سه QTL در شرایط نرمال و 23 QTL در شرایط تنش شناسایی شد. واریانس فنوتیپی کل توجیه شده به‌وسیله این QTL‌ها از 1/9 تا 4/15 درصد متغیر بود که کمترین و بیشترین آن مربوط به صفت طول ریشه‌چه‌ در شرایط 20 دسی زیمنس بر متر بود. از QTL‌های پایدار در هر شش محیط و نشانگر‌های پیوسته با آن‌ها در روش گزینش به کمک نشانگر می‌توان برای بهبود صفات جوانه‌زنی در شرایط تنش شوری پس از آزمایش و تکرار در چند سال استفاده کرد.

کلیدواژه‌ها


عنوان مقاله [English]

Genetic Structure of barley germination components under Normal conditions and Salinity Stress

نویسندگان [English]

  • Sanaz Ghaffari Moghaddam 1
  • hossein sabouri 1
  • Abdollatif Gholizadeh 1
  • Hossein Ali Fallahi 2
1 Department of Plant Production, Collage of agriculture Science and natural resources, Gonbad Kavous University, Gonbad Kavous Gonbad Kavous University, Iran
2 Horticulture Crops Research Department, Mazandaran Agricultural and Education Center, AREEO, Sari, Iran
چکیده [English]

Salinity is one of the main osmotic stresses that limit plants growth and development through changes in osmatic and ionic balance. In order to locate genomic regions controlling quantitative traits locus (QTLs), related to salinity tolerance in the barley and evaluating the relevant indices at the experimental germination stage in 2016 and 2017 using 100 families of the Badia × Comino cross with their parents in a completely Three replications were Randomized and six treatments including normal and five levels of salinity (4, 8, 12, 15 and 20 dS/m). QTL analysis was performed by composite location method based on each of the six treatments. A total of three QTLs were identified under normal conditions and 23 QTLs under stress conditions. The total phenotypic variance explained by these QTLs varied from 9.1 to 15.4 percent, with the lowest and the most related to root length in terms of 20 dS/m. Sustained QTLs in each of the six environments and linked markers in the selection method can be used to improve germination traits under salt stress conditions after several years of testing and repeat.

کلیدواژه‌ها [English]

  • Germination
  • Salinity stress
  • Barley
  • QTL identification

جو (Hordeum vulgare L.) از غلات مهم ایران و جهان و ازنظر اهمیت، چهارمین غلۀ مهم دنیا پس‌از گندم، ذرت و برنج است که مقام اول را ازنظر کشت‌و‌کار در شرایط متنوع آب‌و‌هوایی به‌ویژه آب‌و‌هوای گرم‌ و‌ خشک دارد (FAO, 2013). شوری ازجمله خطر‌های جدی تهدید‌کنندۀ محیط و کشاورزی در بسیاری از بخش‌های جهان است که عملکرد محصولات را به‌ویژه در مناطق خشک و نیمه‌خشک تحت‌تأثیر قرار می‌دهد؛ این مشکل هرساله با تغییرات آب‌و‌هوایی و مدیریت ضعیف سیستم‌های آبیاری افزایش می‌یابد. میزان تحمل به شوری گیاه زراعی بایستی در مراحل مختلف رشد به‌ویژه در مرحلۀ جوانه‌زنی، رشد گیاهچه و مراحل رویشی و زایشی بررسی شود (Mohamadi, 2003). جوانه‌زنی یکی از بحرانی‌ترین مراحل رشد گیاه در شرایط تنش شوری است. Etesami و Galeshi (2008) در مطالعه‌ای، اثر سطوح مختلف تنش شوری را در مرحلۀ جوانه‌زنی جو بررسی و مشخص کردند سرعت جوانه‌زنی حساس‌ترین مرحله نسبت به تنش شوری است. کاهش سرعت جوانه‌زنی در شرایط تنش شوری ممکن است راهکار سازگاری بذر به شرایط تنش محیطی در راستای استقرار بهتر گیاهچه باشد. Munns و James (2003) گزارش کردند گونه‌های بسیاری مانند گندم و جو می‌توانند در غلظت زیاد (30 دسی‌زیمنس بر متر) نمک جوانه بزنند، اما ریشه‌چه‌ نمی‌تواند در این سطح از شوری رشد کند. ارقام مختلف واکنش‌های متفاوتی در برابر تنش شوری نشان می‌دهند که به‌علت تفاوت آنها ازنظر ژنتیکی است (Hussain et al., 1997). معرفی و اصلاح ارقام متحمل به شوری از روش‌های مؤثر مقابله با شوری محسوب می‌شود که در ترکیب با برنامه‌های مدیریتی، امکان بهره‌‌برداری از زمین‌های شور را فراهم می‌کند (Mohamadi, 2003)؛ مقاومت به شوری در گیاهان زراعی، صفت کمّی ژنتیکی و فیزیولوژیکی پیچیده‌ایست که چندین مکان ژنی آن را کنترل می‌کنند (Flowers, 2004). یکی از چالش‌های اصلاح‌ نباتات، نبود اطلاعات کافی دربارۀ ژن‌های کنترل‌کنندۀ صفت‌های کمّی است. مکان‌یابی ژن‌های کنترل‌کنندۀ صفت‌های کمّی، یکی از روش‌هایی است که به‌تازگی برای مطالعۀ ژنتیکی صفت‌های کمّی استفاده می‌شود؛ با شناسایی نواحی ژنومی کنترل‌کنندۀ صفت‌های کمّی و تعیین سهم هریک از این نواحی در ایجاد تنوع مشاهده‌شدۀ صفت در جمعیت، کارایی برنامه‌های به‌نژادی افزایش یافته است و با اطمینان بیشتری می‌توان به اصلاح جمعیت پرداخت(Collard and Mackill, 2008). Czyczyło- Mysza و همکاران (2014) در بررسی مکان‌های ژنی کنترل‌ مرحلۀ جوانه‌زنی و رویشی در 90 هاپلوئید مضاعف گندم بهاره، درمجموع 38 مکان ژنی برای تمام صفت‌های مربوط به مراحل جوانه‌زنی و رویشی شناسایی کردند. Shahraki و همکاران (2013) در مطالعۀ صفت‌های فنولوژیک 72 لاین هاپلوئید مضاعف جو حاصل از تلاقی استپتو و مورکس در شرایط تنش شوری، 31 مکان ژنی را مکان‌یابی کردند. Colmer و همکاران (2006) در شرایط تنش شوری با استفاده از جمعیت هاپلوئید مضاعف حاصل از تلاقی بین دو واریتۀ جو (CT9993×IR62266)، 1 مکان ژنی روی کروموزوم 2 برای صفت طول ساقه‌چه ردیابی کردند. ازآنجاکه شناسایی ژن‌ها و مکان‌های ژنی مؤثر در تحمل به شوری در جو می‌تواند درک بهتری از اصلاح و تحمل به شوری در اختیار اصلاحگر قرار دهد و کمک شایانی برای شناخت بهتر سازوکارهای مولکولی و فیزیولوژیکی باشد، پژوهش حاضر با هدف شناسایی مکان‌های ژنی کنترل‌کنندۀ مؤلفه‌های جوانه‌زنی جو در جمعیت F3 حاصل از تلاقی رقم‌های بادیا×کومینو در شرایط طبیعی و شوری و اشباع نقشۀ پیوستگی جو توسط نشانگر‌های SSR، ISSR و iPBS انجام شد.

 

مواد و روش‌ها.

ارزیابی‌های فنوتیپی: به‌منظور مکان‌یابی صفت‌های مرتبط با جوانه‌زنی، آزمایشی طی سال‌های 1395 و 1396 در آزمایشگاه گیاه‌شناسی دانشگاه گنبد کاووس روی 100 ژنوتیپ نسل F3 جو حاصل از تلاقی دو رقم بادیا×کومینو در قالب طرح کاملاً تصادفی با سه تکرار انجام شد.

به‌منظور آزمون جوانه‌زنی بذرها، 100 خانوادۀ نسل F3 جو حاصل از تلاقی دو رقم بادیا و کومینو به همراه والدین آنها به‌دقت ضدعفونی شدند؛ به‌این‌ترتیب که بذر‌ها 50 ثانیه در محلول هیپوکلریت‌سدیم 2/0 درصد قرار گرفتند و سپس به‌خوبی با آب مقطر استریل شستشو ‌شدند؛ سپس 100 بذر از هر خانواده روی کاغذ واتمن درون پتری‌دیش‌های استریل قرار گرفتند و درنهایت، در شش تیمار شامل تیمار بدون تنش شوری (آب مقطر) و پنج سطح تنش شوری (4، 8، 12، 15 و 20 دسی‌زیمنس بر متر) به‌ترتیب T0، T1، T2، T3، T4 و T5 ارزیابی شدند. تیمار‌های یادشده از اضافه‌شدن به‌ترتیب 25/2، 25/4، 5/7، 11 و 5/13 گرم ‌در ‌لیتر NaCl (آب نمک) به دست آمدند. شمارش بذر‌های جوانه‌زده به‌شکل روزانه و در ساعت‌های معین به‌مدت 7 روز انجام شد. سرعت جوانه‌زنی بر حسب جوانه‌زنی نسبی بذر‌ها در روز به‌ترتیب بر اساس روابط 1 و 2 محاسبه شد (Maguire, 1962). قوۀ نامیۀ بذر از نسبت تعداد بذرهای جوانه‌زده بر تعداد بذرهای کاشته‌شده ضرب در 100 محاسبه شد.

رابطۀ 1

PG=Ni/N×100

رابطۀ 2

PG=X1/Y1+ (X2-X1)/Y2...+(Xn–X1)/Yn

PG: درصد جوانه‌زنی، Ni: تعداد بذر‌های جوانه‌زده در روز iام، N: تعداد کل بذر‌ها، RG: سرعت جوانه‌زنی، Yn: تعداد روز از آغاز آزمایش تا زمان شمارش nام و Xn: درصد بذر‌های جوانه‌زده در شمارش nام است.

درنهایت، 50 گیاهچه به‌طور تصادفی (نمونه‌ای از کل گیاهچه‌ها) نمونه‌برداری و صفت‌های وزن تر دانه (به کمک ترازویی با دقت 001/0 گرم)، وزن خشک دانه (پس‌از قرار‌دادن در آون و دمای 70 درجۀ سانتی‌گراد به‌مدت 72 ساعت به کمک ترازویی با دقت 0001/0 گرم)، طول ساقه‌چه و ریشه‌چه در هر سطح و در هر تکرار (با خط‌کش 1/0 میلی‌متر)، طول و قطر دانه (با کولیس)، وزن‌ تر ساقه‌چه و ریشه‌چه (به کمک ترازویی با دقت 001/0 گرم)، وزن خشک ساقه‌چه و ریشه‌چه (پس‌از قرار‌دادن نمونه‌ها در آون و دمای 70 درجۀ سانتی‌گراد به‌مدت 72 ساعت) اندازه‌گیری شدند.

 

تجزیه واریانس صفت‌های مختلف در وضعیت تنش خشکی و وضعیت طبیعی با نرم‌افزار SAS انجام شد؛ سپس میانگین صفت‌ها در والدین و خانواده‌ها در سطح احتمال 5 درصد و به روش LSD مقایسه شد تا علاوه‌بر بررسی آثار تنش خشکی بر صفت‌های مختلف، ژنوتیپ‌های متحمل و حساس تعیین شوند.

آزمایش‌های مولکولی: ارزیابی‌های مولکولی در آزمایشگاه ژنتیک دانشگاه گنبد کاووس انجام شدند. استخراج DNA به روش CTAB انجام شد (Saghi Maroof et al., 1994) و DNA‌های استخراجی در دمای منفی 20 درجۀ سانتی‌گراد نگهداری شدند. از 28 نشانگر چندشکل SSR، 10 آلل چند‌شکل ISSR و 90 آلل چندشکل iPBS برای اشباع نقشۀ پیوستگی (Kaviani charati et al., 2017) استفاده شد (جدول 1). مبنای انتخاب نشانگر‌های تصادفی، میزان چند‌شکلی آنها در مطالعه‌های پیشین بود. نشانگر‌های SSR نیز به‌گونه‌ای انتخاب شدند که روی هر کروموزوم، نشانگر یادشده وجود داشته باشد. ازآنجاکه میانگین فاصلۀ بین دو نشانگر در پژوهش حاضر کمتر از 20 سانتی‌مورگان بود، این تعداد نشانگر برای نقشه‌یابی مناسب تشخیص داده ‌شد. واکنش زنجیره‌ای پلیمراز (PCR) در حجم 10 میکرولیتر برای هر نمونۀ DNA انجام شد. به‌منظور انجام PCR، ابتدا 2 میکرولیتر DNA ژنومی رقیق‌شده با غلطت 75/0 نانوگرم در هر تیوپ PCR ریخته و سپس 8 میکرولیتر از محلول مادری PCR (غیر از DNA ژنومی) به هر تیوپ اضافه و به‌آرامی تکان داده ‌شد. گفتنی است برای تهیۀ مخلوط واکنش در میکروتیوپ 5/1 میلی‌لیتری به‌ترتیب آب دو بار تقطیر، محلول مادری (با ترکیب Taq DNA Polymerase با غلظت 04/0 واحد بر میکرولیتر، بافر PCR با غلظت نهایی 1x، MgCl2 با غلظت 50 میلی‌مولار، dNTPs با غلظت 10 میلی‌مولار، DNA رقیق‌شده و آغازگرهای مورد‌استفاده) در تیوپ‌های PCR حاوی DNA ریخته شد. برای آغازگرهای SSR، غلظت هرکدام از آغازگرهای رفت و برگشت 60 نانوگرم به میزان 75/0 میکرولیتر و برای آغازگرهای تصادفی ISSR و iPBS، غلظت 60 نانوگرم به میزان 5/1 میکرولیتر در نظر گرفته شد. درنهایت، 4 میکرولیتر روغن معدنی برای جلوگیری از تبخیر مواد درون هر تیوپ اضافه شد. تیوپ‌های PCR در دستگاه ترموسایکلر مدل iCycler (BIORAD ساخت کشور آمریکا) قرار داده شدند. چرخه‌های حرارتی برای تمام نشانگر‌ها به‌طور تاچ‌ داون تنظیم شد. چرخه‌های حرارتی برای نشانگر‌های SSR شامل یک مرحله واسرشت‌سازی اولیه به‌مدت 5 دقیقه در دمای 94 درجۀ سانتی‌گراد، 35 چرخه شامل واسرشت‌سازی در دمای 94 درجۀ سانتی‌گراد به‌مدت 1 دقیقه، اتصال آغاز‌گرها به‌مدت 1 دقیقه در دمای اختصاصی آنها و بسط در دمای 72 درجۀ سانتی‌گراد به‌مدت 2 دقیقه و درنهایت، مرحلۀ تکثیر نهایی به‌مدت 5 دقیقه در دمای 72 درجۀ سانتی‌گراد بود. چرخه‌های حرارتی برای نشانگر‌های ISSR وiPBS  شامل یک مرحله واسرشت‌سازی اولیه به‌مدت 5 دقیقه در دمای 95 درجۀ سانتی‌گراد، مرحلۀ واسرشت‌سازی در دمای 95 درجۀ سانتی‌گراد به‌مدت 45 ثانیه، 10 چرخۀ اتصال آغازگر‌ها در دمای 52 تا 64 درجۀ سانتی‌گراد به‌مدت 45 ثانیه و بسط در دمای 72 درجۀ سانتی‌گراد به‌مدت 45 ثانیه، 25 چرخۀ اتصال آغازگر‌ها در دمای اختصاصی آنها به‌مدت 45 ثانیه و درنهایت، یک مرحله تکثیر نهایی در دمای 72 درجۀ سانتی‌گراد به‌مدت 5 دقیقه بود. فراورده‌های واکنش PCR با الکتروفورز روی ژل پلی‌اکریل‌آمید واسرشته‌ساز 6 درصد تفکیک و نمایان‌سازی باند‌ها با روشی موسوم به روش سریع رنگ‌آمیزی نقره (Caetano Anolles and Gresshoff, 1994) انجام شد. نظر به اینکه نشانگرهای نقشه‌شده مانند SSR جایگاه ژنومی مشخصی دارند، برای تهیه نقشۀ پیوستگی ابتدا با نشانگرهای SSR آغاز کردیم و پس‌از تعیین نقشۀ اولیه، انکورکردن نشانگرهای تصادفی به نقشۀ اولیه انجام شد.به‌منظور تهیۀ نقشۀ ژنتیکی در جمعیت F3 از نرم‌افزار Map Manager QTX استفاده شد؛ فـواصل نشانگری در این نقشه بر اساس تابع کوزامبی محاسبه شدند (Kosambi, 1994). به‌منظور یافتن مکان‌های ژنی از QGENE استفاده شد (Nelson, 1997). به‌منظور تعیین مکان‌های ژنی و برآورد اندازۀ آثار آنها از روش نقشه‌یابی فاصله‌ای مرکب CIM استفاده شد و نقطه‌ای که بیشترین مقدار  LODرا داشت، ناحیۀ با بیشترین احتمال وجود مکان ژنی شناسایی شد. در تمام موارد از پرمیوتیشن و 1000 Resampling استفاده و برای هر پایش 5/0 سانتی‌مورگان در نظر گرفته شد و بر اساس آن، LOD 2 به بالا حد بحرانی در نظر گرفته شد. نظر به اینکه برخی از صفت‌ها توزیع نرمال نداشتند، از تبدیل داده‌ها و همچنین روش حداکثر درست‌نمایی برای جلوگیری از اریبی نتایج استفاده ‌شد (Haley and Knott, 1992). به‌منظور تهیۀ نقشۀ ژنتیکی از اسکورهای 1 برای وجود باند و 2 برای وجودنداشتن باند در نشانگرهای ریزماهواره استفاده شد. درمورد نشانگرهای iPBS، از اسکورهای 1برای وجود باند و 3 برای ‌وجودنداشتن باند در مواقعی که باند در والد اول تکثیر یافته بود، استفاده شد. همچنین درمورد نشانگرهای iPBS از نمره‌های 2 برای وجود باند و 4 برای ‌وجودنداشتن باند در مواقعی که باند در والد دوم تکثیر یافته بود، استفاده شد. گفتنی است برچسب‌زدن نشانگرهای تصادفی به نشانگرهای ریزماهواره برای کروموزوم‌ها جداگانه انجام ‌شد.

 

 

جدول 1- نشانگرهای SSR، ISSR و iPBS چندشکل مورداستفاده در تهیۀ نقشۀ پیوستگی جمعیت F3 جو حاصل از تلاقی ارقام بادیا×کومینو (برنامۀ حرارتی و غلظت‌ها در متن درج شده است)

آغاز‌گر

کروموزوم

توالی آغازگر ('3-'5)

ریزماهواره‌ (SSR)

Bmag0782

1

F: ATGTACCATTACGCATCCA

R: GAAATGTAGAGATGGCACTTG

Bmag0718

1

F: ATCGTGACATCTCAAGAACA

R: CCTGATACTGCCTAGCATTAG

Bmag0211

1

F: ATTCATCGATCTTGTATTAGTCC

R: ACATCATGTCGATCAAAGC

HVM20

1

F: CTCCACGAATCTCTGCACAA

R: CACCGCCTCCTCTTTCAC

EBmac624

2

F: AAAAGCATTCAACTTCATAAGA

R: CAACGCCATCACGTAATA

Bmag382

2

F: TGAAACCCATAGAGAGTGAGA

R: TCAAAAGTTTCGTTCCAAATA

GBMS0160

2

F: ATCCAGTGGCCTTTGTATGG

R: TCAGCTCCTCTCTCTTCATGTG

HVM36

2

F: TCCAGCCGAACAATTTCTTG

R: AGTACTCCGACACCACGTCC

HVM33

3

F: ATATTAAAAAAGGTGGAAAGCC

R: CACGCCCTCTCCCTAGAT

Bmac0209

3

F: CTAGCAACTTCCCAACGAC

R: ATGCCTGTGTGTGGACCAT

GBMS0046

3

F: CACACAAAAGCTGACTTAATTCC

R: TGGAAACCAAGCCTTACCAC

Bmag0225

3

F: AACACACCAAAAATATTACATCA

R: CGAGTAGTTCCCATGTGAC

HVM67

4

F: GTCGGGCTCCATTGCTCT

R: CCGGTACCCAGTGACGAC

EBmac0755

7

F: GCTTCCTTCATAGACCCAT

R: ATATCATGCCAATGGTGTC

EBmac0701

4

F: ATGATGAGAACTCTTCACCC

R: TGGCACTAAAGCAAAAGAC

D4ff

4

F:CAATCCTTGCATCAAATGTGC

R:GGCCCTAAGATAGAAGCACAAG

MGB402

4

F: CAAGCAAGCAAGCAGAGAGA

R: AACTTGTGGCTCTGCCGACTC

HVM30

5

F: AGTGGGGAATGAGAGAATGG

R: TGCTTGTGGGTCATCACAC

GBMS0032

5

F: CAGCATCCATCAGCAATGTT

R: ATGTTTGGCTTCTTCGTCGT

Bmag0223

5

F: TTAGTCACCCTCAACGGT

R: CCCCTAACTGCTGTGATG

GMS001

5

F: CTGACCCTTTGCTTAACATGC

R: TCAGCGTGACAAACAATAAAGG

HVM65

6

F: AGACATCCAAAAAATGAACCA

R: TGGTAACTTGTCCCCCAAAG

GBMS180

6

F: GGAACTAATGCTTCGGTCCA

R: TGGTGCAAGTGAGCACCTAC

MGB371

6

F: CACCAAGTTCACCTCGTCCT

R: TTATTCAGGCAGCACCATTG

Bmac0040

6

F: AGCCCGATCAGATTTACG

R: TTCTCCCTTTGGTCCTTG

HVM49

7

F: CTCTATAGGCACGAAAAATTCC

R: TTGCACATATCTCTCTGTCACA

GBMS0183

7

F: TAATGGTGATGGTCTTGAGGC

R: AAGACTCGCGTGCCTTTTAA

MGB318

7

F: CGGCTCAGGTCTCTTCTTC

R: TATCTAGATGCCCCTTTCC

بین ریزماهواره‌ای (ISSR)

 

نام آغاز‌گر

توالی آغازگر ('3-'5)

 

ISSR16

CTCTCTCTCTCTCTCTG

 

ISSR29

TCTCTCTCTCTCTCTCA

 

ISSR20

TCTCTCTCTCTCTCG

 

ISSR13

GACAGAGAGAGAGAGAA

 

رتروترانسپوزون (iPBS)

 

2240

AACCTGGCTCAGATGCCA

 

2232

AGAGAGGCTCGGATACCA

 

2222

ACTTGGATGCCGATACCA

 

2244

GGAAGGCTCTGATTACCA

 

2400

CCCCTCCTTCTAGCGCCA

 

2221

ACCTAGCTCATGATGCCA

 

2239

ACCTAGGCTCGGATGCCA

 

2077

CTCACGATGCCA

 

2274

GCTCTGATACCA

 

2083

CTTCTAGCGCCA

 

2076

GCTCCGATGCCA

 

2074

CTCATGATGCCA

 

2241

ACCTAGCTCATCATGCCA

 

2231

ACTTGGATGCTGATACCA

 
       

 


نتایج و بحث

تجزیه واریانس، توزیع فنوتیپی و مقایسه میانگین صفت‌های موردبررسی در والدین: نتایج تجزیه واریانس صفت‌های موردمطالعه در مرحلۀ جوانه‌زنی (جدول 2) پس‌از بررسی و تأیید برقراری مفروضات نشان داد ژنوتیپ‌های بررسی‌شده ازنظر تمام صفت‌های ارزیابی‌شده در سطح احتمال 1 درصد اختلاف معنادار دارند. تأثیر سطوح مختلف شوری بر صفت‌های یادشده نیز در سطح احتمال 1 درصد معنا‌دار بود. این نتیجه نشان‌دهندۀ تنوع فنوتیپی زیاد در جمعیت است. اختلاف آماری معنا‌دار بین ژنوتیپ‌ها بیان‌کنندۀ وجود تنوع زیاد بین مواد گیاهی ارزیابی‌شده و احتمالاً ساز‌وکار‌های متفاوت آنها در واکنش به تنش شوری است که می‌توانند در انتخاب ژنوتیپ مناسب و تولید جمعیت‌های درحال تفرق به‌منظور مکان‌یابی ژنی استفاده شوند. مشابه نتایج پژوهش حاضر از مطالعۀ Fakheri و Khalegh Babaki (2014) روی نقشه‌یابی نواحی ژنومی کنترل‌کنندۀ صفت‌های فیزیولوژیک و مورفولوژیک مرتبط با جوانه‌زنی گندم نان در وضعیت طبیعی و تنش اسمزی بین دو محیط طبیعی و تنش به دست آمده است که اختلاف معنا‌دار بین ژنوتیپ‌ها را مشاهده کردند. طبق نتایج حاصل از آماره‌های توصیفی چولگی و کشیدگی، توزیع فنوتیپی صفت‌ها به‌شکل نرمال بود و بررسی مقایسه میانگین صفت‌های موردبررسی در والدین تلاقی بادیا×کومینو در جدول 3 به روش آزمون t محاسبه شد. نرمال‌بودن صفت‌ها نشان از ماهیت کمّی آنها دارد.

 

 

جدول 2- نتایج تجزیه واریانس خانوادۀ F3 حاصل از تلاقی بادیا×کومینو مرحلۀ جوانه‌زنی در شرایط طبیعی وشوری

منابع تغییرات

درجۀ آزادی

سرعت جوانه‌زنی

درصد جوانه‌زنی

قوۀ نامیۀ بذر

وزن دانه

وزن خشک دانه

وزن تر دانه

طول دانه

قطر دانه

طول ساقه‌چه

طول ریشه‌چه

وزن تر ساقه‌چه

وزن تر ریشه‌چه

وزن خشک ساقه‌چه

وزن خشک ریشه‌چه

میانگین مربعات شرایط طبیعی

ژنوتیپ

101

**06/0

**67/621

**02/113

**67/0

**001/0

**43/2

**53/28

**73/4

**10/24

**49/16

**63/6

**45/2

**0002/0

**00006/0

خطا

204

005/0

39/52

38/5

002/0

0006/0

01/0

005/0

11/0

24/0

02/0

005/0

07/0

00001/0

000001/0

ضریب تغییرات (درصد)

 

10/3

10/3

46/2

43/1

71/42

18/1

18/0

90/2

17/1

45/0

93/0

33/4

70/11

21/5

میانگین مربعات تنش 4 دسی‌زیمنس بر متر

ژنوتیپ

101

**05/0

**82/543

**38/138

**60/0

**001/0

**19/2

**90/27

**47/5

**70/15

**35/16

**30/7

**75/2

**0001/0

**00009/0

خطا

204

003/0

60/30

84/12

005/0

0008/0

0006/0

01/0

24/0

67/0

007/0

01/0

07/0

000009/0

0000006/0

ضریب تغییرات (درصد)

 

40/2

40/2

49/2

94/1

74/5

08/1

26/0

22/4

99/1

29/0

59/1

30/4

26/17

50/7

میانگین مربعات تنش 8 دسی‌زیمنس بر متر

ژنوتیپ

101

**01/0

**37/105

**17/390

**57/0

**0001/0

**41/2

**12/5

**51/27

**84/15

**11/16

**98/6

**67/2

**00007/0

**00006/0

خطا

204

002/0

26/22

12/23

009/0

000007/0

12/0

38/0

08/0

67/0

12/0

12/0

076/0

00001/0

000006/0

ضریب تغییرات (درصد)

 

27/2

26/2

18/6

55/2

62/5

03/5

26/5

71/0

01/2

21/1

56/4

66/4

20/19

86/24

میانگین مربعات تنش 12 دسی‌زیمنس بر متر

ژنوتیپ

101

**012/0

**40/124

**32/378

**51/0

**0005/0

**23/4

**41/20

**65/2

**63/10

**56/12

**81/6

**62/2

**00004/0

**00006/0

خطا

204

001/0

15/18

49/10

07/0

000008/0

003/0

63/0

02/0

22/3

22/0

06/0

04/0

000008/0

000004/0

ضریب تغییرات (درصد)

 

99/1

98/1

08/5

32/7

29/4

79/0

007/2

35/1

78/4

61/1

32/3

60/3

82/16

28/18

میانگین مربعات تنش 15 دسی‌زیمنس بر متر

ژنوتیپ

101

**003/0

**58/38

**14/446

**39/0

**0003/0

**70/1

**16/22

**53/2

**12/10

**72/8

**59/2

**13/0

**00006/0

**000001/0

خطا

204

001/0

10/16

30/41

07/0

00003/0

03/0

01/0

02/0

65/0

07/0

44/0

01/0

000001/0

0000002/0

ضریب تغییرات (درصد)

 

99/1

99/1

90/10

24/7

23/9

16/3

30/0

23/1

83/2

17/1

61/18

55/22

47/11

67/42

میانگین مربعات تنش 20 دسی‌زیمنس بر متر

ژنوتیپ

101

07/0

**95/280

**29/163

**39/0

**0001/0

**71/1

**63/17

**66/2

**42/6

**46/8

**17/2

**76/2

**00004/0

**00004/0

خطا

204

0011/0

517/11

40/13

07/0

000006/0

03/0

07/0

01/0

05/0

35/0

34/0

32/0

000001/0

0000009/0

ضریب تغییرات (درصد)

 

306/1

771/1

54/8

24/7

22/4

16/3

67/0

07/1

88/0

69/2

37/17

32/23

10/12

43/31

** معنا‌دار در سطح احتمال 1 درصد

                                 

 

جدول 3- مقایسه میانگین صفت‌های موردبررسی در مرحلۀ جوانه‌زنی برای والدین تلاقی (بادیا×کومینو)

 

T0

T1

T2

T3

T4

T5

صفت

بادیا

کومینو

آماره

بادیا

کومینو

آماره

بادیا

کومینو

آماره

بادیا

کومینو

آماره

بادیا

کومینو

آماره

بادیا

کومینو

آماره

سرعت جوانه‌زنی

28/2

20/2

ns

35/2

10/2

*

06/2

05/2

ns

18/2

18/2

ns

06/2

00/2

*

00/2

00/2

ns

درصد جوانه‌زنی

00/100

00/100

ns

00/100

00/95

**

00/93

00/92

*

00/97

00/97

ns

00/93

00/90

*

00/90

00/90

ns

قوۀ نامیۀ بذر

33/87

00/100

**

66/89

66/94

*

33/72

00/90

**

66/64

33/67

*

33/37

00/100

**

33/27

00/100

**

وزن خشک دانه (گرم)

067/0

045/0

*

060/0

040/0

*

052/0

042/0

*

100/0

077/0

*

075/0

092/0

*

062/0

092/0

*

طول دانه (میلی‌متر)

46/42

01/42

ns

36/42

95/41

*

36/42

20/42

ns

20/36

06/41

**

41/36

26/26

**

35/36

15/41

**

قطر دانه (میلی‌متر)

96/10

70/11

ns

91/10

75/11

*

95/10

75/11

*

96/11

10/11

ns

75/11

26/11

ns

95/11

16/11

ns

طول ساقه‌چه (سانتی‌متر)

7/43

3/39

*

60/38

25/39

*

11/38

00/39

*

31/37

40/26

**

56/27

56/35

**

31/26

55/33

**

طول ریشه‌چه (سانتی‌متر)

6/31

6/36

*

3/26

7/31

**

1/26

9/31

**

01/26

00/34

**

16/21

16/28

**

60/15

70/25

**

وزن تر ساقه‌چه (گرم)

617/5

650/7

*

350/5

467/7

**

017/5

167/7

**

967/4

700/7

**

317/2

367/5

**

100/2

150/5

**

وزن تر ریشه‌چه (گرم)

350/4

900/5

*

917/3

667/5

*

717/3

367/5

**

650/3

150/5

**

605/0

883/0

**

543/0

761/0

**

وزن خشک ساقه‌چه (گرم)

542/2

668/2

*

981/1

632/2

**

776/1

457/2

*

423/1

781/1

*

158/1

457/1

**

021/1

129/1

**

وزن خشک ریشه‌چه (گرم)

701/1

039/2

*

653/1

858/1

**

536/1

778/1

**

225/1

543/1

**

253/0

472/0

*

068/0

096/0

**

**، * و ns به‌ترتیب نشان‌دهندۀ معناداری در سطح احتمال 1 درصد، 5 درصد و غیر‌معنا‌دار است.

T0، T1، T2، T3، T4 و T5 به‌ترتیب تیمار بدون تنش شوری (آب مقطر) و پنج سطح تنش شوری 4، 8، 12، 15 و 20 دسی‌زیمنس بر متر را نشان می‌دهند.


.مکان‌یابی مکان‌های ژنی کنترل‌کنندۀ صفت‌های موردبررسی: نقشۀ پیوستگی جو با استفاده از نشانگر‌های SSR، ISSR و iPBS ترسیم شد و 6/665 سانتی‌مورگان از ژنوم جو را پوشش داد (شکل 1). طی مرحلۀ جوانه‌زنی در شرایط طبیعی و تنش شوری، درمجموع 26 عدد مکان‌ ژنی برای صفت‌های موردمطالعه شناسایی شدند (جدول 4). نواحی ژنومی و کروموزومی مکان‌های ژنی مکان‌یابی‌شده در شرایط موردارزیابی به‌طور واضح‌تر در شکل 1 مشاهده می‌شوند.

 

 

شکل 1- نقشه پیوستگی حاصل از شانگر‌های SSR، ISSR و IPBS در جمععیت F3 جوحاصل از تلاقی بادیا × کومینو (محل تقریبی QTLها در جداول 4 و 5 آمده است).

Ch7

Ch6

Ch5

Ch4

Ch3

Ch2

Ch1

 

 

 


الف- شرایط طبیعی: در شرایط طبیعی، یک مکان‌ ژنی روی کروموزوم 5 برای صفت وزن خشک دانه شناسایی شد. qSDW-5a توانست 3/12 درصد از واریانس فنوتیپی را توجیه کند و والد بادیا سبب افزایش وزن خشک دانه شد. Khalili و Mohammadi (2015) سه مکان ژنی روی کروموزوم‌های 1، 2 و 3 جو برای وزن خشک دانه گزارش کردند که با نتایج پژوهش حاضر مطابقت ندارد. یک مکان ژنی روی کروموزوم‌ 2 برای صفت طول ساقه‌چه و در فاصلۀ ژنومی IPBS2077-5-EBMAO624 شناسایی شد که 4/14 درصد از تغییرات فنوتیپی را توجیه کرد. این مکان ژنی به‌عنوان مکان ژنی بزرگ‌اثر کنترل‌کنندۀ طول ساقه‌چه در شرایط طبیعی شناسایی شد و برای گزینش پیشنهاد می‌شود. Sabouri و همکاران (2010( شش مکان ژنی مرتبط با طول ساقه‌چه‌ را در شرایط تنش اسمزی ناشی از سوربیتول روی کروموزوم‌های 1، 2، 4، 5، 7 و 12 شناسایی کردند که با مطالعۀ حاضر مطابقت دارد. یک مکان‌ ژنی روی کروموزوم 4 برای صفت وزن خشک ساقه‌چه در فاصلۀ نشانگری IPBS2239-2–IPBS2241-1 شناسایی شد. این مکان‌ ژنی توانست 8/9 درصد از واریانس فنوتیپی وزن خشک ساقه‌چه را توجیه کند و آلل‌های والد کومینو سبب کاهش وزن خشک ساقه‌چه شدند. Rabie و همکاران (2013) یک مکان ژنی برای صفت وزن خشک ساقه‌چه در حدفاصل نشانگر‌های RM5711-E36-M59-1 روی کروموزوم 7 در دو وضعیت شوری و خشکی شناسایی کردند که با نتایج پژوهش حاضر مطابقت ندارد.

ب- تنش 4 دسی‌زیمنس بر متر: در تنش 4 دسی‌زیمنس بر متر، دو مکان ژنی  بزرگ‌اثر روی کروموزوم‌های 6 و 7 برای صفت سرعت جوانه‌زنی شناسایی شدند و این مکان‌های ژنی به‌ترتیب با نشانگر‌های iPBS2077-2–GBMS0183 و HVM65–BMAC0040 پیوستگی داشتند و به‌ترتیب دارای واریانس فنوتیپی 6/11 و 6/10 درصد بودند. Zhang و همکاران (2005) مکان‌های ژنی مرتبط با سرعت جوانه‌زنی را روی کروموزوم‌های 1، 4 و 7 ردیابی کردند. موقعیت مکانی qGS4-7 در مطالعۀ حاضر با مکان‌های ژنی‌ای مطابقت دارد که Zhang و همکاران (2005) ردیابی‌ کردند. در مقابل، Liang و همکاران (2006) دو مکان‌ ژنی روی کروموزوم‌های 3 و 10 برای سرعت جوانه‌زنی تعیین کردند که با نتایج پژوهش حاضر کاملاً متفاوت است. ازجمله دلایل مطابقت‌نداشتن نتایج پژوهش حاضر با نتایج سایر پژوهشگران را می‌توان تعداد و نوع نشانگرهای بررسی‌شده، نوع جمعیت، تعداد افراد استفاده‌شده در جمعیت، نوع والدین استفاده‌شده و شرایط محیطی دانست. دو مکان ژنی بزرگ‌اثر روی کروموزوم‌های 6 و 7 برای صفت درصد جوانه‌زنی در فاصلۀ نشانگری مشابه صفت سرعت جوانه‌زنی شناسایی شدند و درمجموع، 3/22 درصد از تغییرات فنوتیپی را توجیه کردند. Miura و همکاران (2004) در وضعیت تنش دمایی، پنج مکان ژنی را برای درصد جوانه‌زنی روی کروموزوم‌های 2، 4، 5 و 11 (دو مکان‌ ژنی) به‌ترتیب با 9/11، 9/14، 1/10، 6/10، 5/11 درصد توجیه تغییرات فنوتیپی ردیابی کردند که با مکان‌های ژنی شناسایی‌شده در پژوهش حاضر مطابقت ندارد. دو مکان‌ ژنی روی کروموزوم‌های ‌7 و 2 برای قوۀ نامیه بذر شناسایی شدند که درمجموع، 1/21 درصد از تغییرات فنوتیپی صفت قوۀ نامیه بذر را توصیف کردند و آلل‌های والدین به‌ترتیب بادیا و کومینو باعث کاهش و افزایش این صفت شدند. یک مکان ژنی برای وزن خشک دانه روی کروموزوم 4 مکان‌یابی شد؛ والد بادیا سبب افزایش این صفت شد. qSDW4-4a در فاصلۀ نشانگری IPBS2240-IPBS2081-3، 7/9 درصد از تغییرات فنوتیپی را توجیه کرد. یک مکان‌ ژنی برای صفت طول ساقه‌چه روی کروموزوم‌ 2 مکان‌یابی شد. qASL-2a در فاصلۀ ژنومی IPBS2077-5–EBMAO624 قرار داشت و 4/11 درصد از واریانس تغییرات را توجیه کرد و آلل‌های والد کومینو باعث افزایش این صفت شدند. یک مکان‌ ژنی دیگر در این سطح از تنش شوری برای صفت وزن‌ تر ساقه‌چه روی کروموزوم 2 مکان‌یابی شد.qSFW-2a  دارای اثر افزایشی کاهشی بود که از والد بادیا به نتایج منتقل شده‌ بود.

ج- تنش 12 دسی‌زیمنس بر متر: در شرایط تنش شوری 12 دسی‌زیمنس بر متر، سه مکان‌ ژنی برای صفت‌های ارزیابی‌شده در مرحلۀ جوانه‌زنی شناسایی شدند (جدول 4). دو مکان‌ ژنی در کنترل صفت وزن خشک دانه نقش داشتند که درمجموع 5/22 درصد از تغییرات فنوتیپی را توجیه کردند. یک مکان ژنی برای صفت طول ساقه‌چه روی کروموزوم 1 مکان‌یابی شد؛ این مکان‌ ژنی در فاصلۀ نشانگری BMAG0211–IPBS2221-3 قرار داشت و 5/12 درصد از واریانس فنوتیپی را توجیه کرد.Rabei  و همکاران (2014) مکان‌های ژنی مرتبط با تحمل به شوری و خشکی را در دو مرحلۀ جوانه‌زنی و گیاهچه‌ای جمعیت F2:4 با استفاده از 105 نشانگر AFLP و 131 نشانگر ریزماهواره ردیابی کردند و یک مکان‌ ژنی برای سرعت جوانه‌زنی، یک مکان ژنی برای درصد جوانه‌زنی و یک مکان ژنی برای طول ساقه‌چه‌ در کروموزوم 1 ردیابی کردند.

د- تنش 15 دسی‌زیمنس بر متر: در تنش 15 دسی‌زیمنس بر متر، سه مکان‌ ژنی کنترل‌کنندۀ طول ریشه‌چه‌ روی کروموزوم‌های 2، 6 و 7 مکان‌یابی شدند؛ این سه مکان‌ ژنی درمجموع 4/30 درصد از تغییرات فنوتیپی را توجیه کردند. Khalili و همکاران (2017) سه مکان‌ ژنی روی کروموزوم‌های 3B، 2A و 2D برای طول ریشه‌چه‌ مکان‌یابی کردند؛ این سه مکان ژنی درمجموع 8/48 درصد از تغییرات فنوتیپی را تبیین کردند که با نتایج پژوهش حاضر مطابقت دارد. یک مکان ژنی روی کروموزوم 4 برای صفت وزن‌ تر ساقه‌چه در فاصلۀ نشانگری D4ff–iPBS2241-2 شناسایی شد و 4/9 درصد از تغییرات فنوتیپی را توجیه کرد. مکان‌های ژنی qRFW15-4a و qRFW15-7a برای صفت وزن تر ریشه‌چه روی کروموزوم‌های 4 و 7 شناسایی شدند. ضریب تبیین برای دو مکان ژنی به‌ترتیب برابر با 9/10 و 7/9 درصد بود. اثر افزایشی نیز به‌ترتیب افزایشی و کاهشی بود که والد کومینو سبب افزایش این صفت و والد بادیا سبب کاهش این صفت شد. یک مکان ژنی برای صفت قوۀ نامیۀ بذر روی کروموزوم 1 و در فاصلۀ نشانگری IPBS2221-2–IPBS2239-3 و ضریب تبیین برابر با 7/11 درصد مکان‌یابی شد. یک مکان‌ ژنی در فاصلۀ نشانگری HVM36–IPBS2240-7 روی کروموزوم 2 برای وزن خشک دانه شناسایی شد. qSV15-1a دارای LOD برابر با 280/2 و ضریب تبیین 10 بود. درنهایت، یک مکان‌ ژنی برای قطر دانه روی کروموزوم 6 و در فاصلۀ ژنومی IPBS2241-4–IPBS2077-1 مکان‌یابی شد و 8/12 درصد از واریانس فنوتیپی را توجیه کرد. اثر افزایشی برای این صفت منفی و از والد کومینو گرفته شد.

م- تنش 20 دسی‌زیمنس بر متر: در شرایط تنش 20 دسی‌زیمنس بر متر، دو مکان ژنی در کنترل صفت طول ریشه‌چه نقش داشتند که روی کروموزوم‌های 2 و 7 شناسایی شدند. ضریب تبیین برای این دو مکان ژنی به‌ترتیب برابر با 4/15 و 1/9 درصد بود.

 

 

جدول 4- مکان‌یابی مکان‌های ژنی کنترل‌کنندۀ صفت‌های موردبررسی در مرحلۀ جوانه‌زنی در شرایط طبیعی و تنش شوری

صفت

مکان ژنی

شمارۀ کروموزومی

موقعیت

نشانگر‌های مجاور

LOD

فاصلۀ  مکان ژنی تا نزدیک‌ترین نشانگر

اثر افزایشی

ضریب تبیین

جهت آلل

شرایط طبیعی (Normal)

وزن خشک دانه

qSDW-5a

5

60

iPBS2222ISSR13--iPBS2221-5

852/2

3/0

725/15

3/12

بادیا

طول ساقه‌چه

qASL-2a

2

16

iPBS2077-5-EBMAO624

380/3

7/1

891/2

4/14

بادیا

وزن خشک ساقه‌چه

qSDW-4a

4

118

iPBS2239-2-iPBS2241-1

250/2

3/0

023/0

8/9

کومینو

4 دسی‌زیمنس بر متر (4 dS/m)

سرعت جوانه زنی

qGS4-7a

7

14

iPBS2077-2-GBMS0183

680/2

3/1

089/0

6/11

بادیا

 

qGS4-6a

6

50

HVM65-BMAC0040

438/2

8/4

074/0

6/10

بادیا

درصد جوانه زنی

qGP4-7a

7

14

iPBS2077-2-GBMS0183

687/2

3/1

87/8

6/11

بادیا

 

qGP4-6a

6

50

HVM65-BMAC0040

446/2

8/4

431/7

7/10

بادیا

قوه نامیه بذر

qSV4-7a

7

14

iPBS2077-2-GBMS0183

464/2

3/1

180/4-

7/10

بادیا

 

qSV4-2a

2

64

BMAG382-iPBS2221-6

389/2

5/1

411/3

4/10

کومینو

وزن خشک دانه

qSDW4-4a

4

26

iPBS2240-4-iPBS2081-3

220/2

9/0

020/0

7/9

بادیا

طول ساقه‌چه

qASL4-2a

2

16

iPBS2077-5-EBMAO624

629/2

7/1

085/2

4/11

کومینو

وزن تر ساقه‌چه

qSFW4-2a

2

114

iPBS2274-1-iPBS2083-2

268/2

1

809/1-

9/9

بادیا

12 دسی‌زیمنس بر متر (12 dS/m)

وزن خشک دانه

qSDW12-6a

6

2

iPBS2241-4-iPBS2077-1

758/2

0/2

035/0

9/11

بادیا

 

qSDW12-4a

4

122

iPBS2241-1-iPBS2241-6

422/2

7/3

013/0

6/10

بادیا

طول ساقه‌چه

qASL12-1

1

76

BMAG0211-iPBS2221-3

2.893

4/1

029/1

5/12

بادیا

15 دسی‌زیمنس بر متر (15 dS/m )

 

qARL15-6a

6

46

HVM65-BMAC0040

437/2

9/4

794/0-

6/10

بادیا

طول ریشه‌چه

qARL15-2a

2

112

iPBS2232-3-iPBS2274-1

430/2

1

686/173

6/10

کومینو

 

qARL15-7a

7

66

IPBS2231-7-EBMAC0755

100/2

3/0

665/0-

2/9

بادیا

وزن تر ساقه‌چه

qSFW15-4

4

40

D4ff–iPBS2241-2

132/2

26/0

378/0-

4/9

بادیا

وزن تر ریشه‌چه

qRFW15-4a

4

26

iPBS2240-4-iPBS2081-3

499/2

9/0

233/0

9/10

کومینو

 

qRFW15-7a

7

78

iPBS2074-5-iPBS2241-3

220/2

3/1

668/0-

7/9

بادیا

قوه نامیه بذر

qSV15-1

1

0

iPBS2221-2-iPBS2239-3

709/2

0

837/7

7/11

کومینو

وزن خشک دانه

qSDW15-2

2

12

HVM36-iPBS2240-7

280/2

4/0

005/0-

10

بادیا

قطر دانه

qAGD15-6

6

0

iPBS2241-4-iPBS2077-1

980/2

0

245258-

8/12

کومینو

20 دسی‌زیمنس بر متر (20 dS/m )

طول ریشه‌چه

qARL20-2a

2

112

iPBS2232-3-iPBS2274-1

622/3

1

956/194

4/15

کومینو

 

qARL20-7a

7

68

EBMAC0755-iPBS2074-5

061/2

4/3

685/0-

1/9

بادیا


 


مکان‌های ژنی ‌مکان‌یابی‌شدۀ مشترک برای صفت‌های مطالعه‌شده: جایگاه کروموزومی مکان‌های ژنی مکان‌یابی‌شدۀ مشترک برای صفت‌های موردمطالعه در جدول 5 ارائه شده است. مقایسۀ جایگاه کروموزومی مکان‌های ژنی شناسایی‌شده در مرحلۀ جوانه‌زنی نشان داد برخی از مکان‌های ژنی روی نواحی ژنومی و کروموزومی مشترک قرار دارند؛ این موضوع احتمالاً به‌علت پیوستگی ژنتیکی یا اثر پلیوتروپیک ژنی است.

 

 

جدول 5- مکان‌های ژنی مکان‌یابی‌شدۀ مشترک برای صفت‌های موردمطالعه در مرحلۀ جوانه‌زنی

 

 

شرایط محیطی

فاصلۀ نشانگری

شمارۀ کروموزوم

شرایط طبیعی

4 دسی‌زیمنس بر متر

12 دسی‌زیمنس بر متر

15 دسی‌زیمنس بر متر

iPBS2077-5- EBMAC624

2

طول ساقه‌چه

طول ساقه‌چه

 

 

iPBS2240-4- iPBS2081-3

4

 

وزن خشک دانه

 

وزن تر ریشه‌چه

iPBS2241-4- iPBS2077-1

6

 

 

وزن خشک دانه

قطر دانه

HVM65- Bmac0040

6

 

سرعت جوانه‌زنی+درصد جوانه‌زنی

 

طول ریشه‌چه

iPBS2077-2- GBMS0183

7

 

قوۀ نامیۀ بذر+سرعت جوانه‌زنی+ درصد جوانه‌زنی

 

 

             

 


با‌توجه‌به نتایج، کروموزوم شمارۀ 7 و نواحی ژنومی iPBS2231-1–iPBS2274-5 و iPBS2077-2–GBMS0183 به‌علت شناسایی بیشترین مکان‌های ژنی کنترل‌کنندۀ صفت‌های موردبررسی در مرحلۀ رشدی جوانه‌زنی در این نواحی می‌توانند به‌عنوان مکان و نواحی مهم و تعیین‌کننده برای اصلاح و برنامه‌های به‌نژادی استفاده شوند. حضور یک مکان‌ ژنی در شرایط مختلف بیان‌کنندۀ ثبات ژن است؛ بنابراین به نظر می‌رسد بتوان این مکان‌های ژنی را در زمرۀ مکان‌های ژنی پایدار و اصلی کنترل‌کنندۀ صفت‌های موردبررسی محسوب کرد و با اطمینان بیشتر از آنها در برنامۀ گزینش به کمک نشانگر به‌عنوان مکمل روش‌های اصلاح کلاسیک استفاده کرد؛ هرچند بین سایر مکان‌های ژنی کنترل‌کنندۀ همین صفت‌ها یا سایر صفت‌ها، مکان‌های ژنی پراثری شناسایی شده‌اند که به یک محیط اختصاص دارند و استفاده از آنها در برنامه‌های به‌نژادی منطقه‌ای مؤثر است.

 

جمع‌‌بندی

نتایج تجزیه واریانس نشان دادند اختلاف معناداری در سطح احتمال 1 درصد بین ژنوتیپ‌ها در تمام صفت‌های ارزیابی‌شده در مرحلۀ جوانه‌زنی مشاهده می‌شود؛ ازاین‌رو می‌توان گفت تنوع ژنتیکی مطلوبی بین ژنوتیپ‌ها وجود دارد. نواحی ژنومی iPBS2077-2–GBMS0183 و HVM65–Bmac0040 به‌علت شناسایی بیشترین مکان ژنی به‌عنوان مهم‌ترین فواصل نشانگری شناسایی شدند. استفاده از مکان‌های ژنی هم‌مکان در شرایط مختلف محیطی پس‌از تعیین اعتبار در نسل‌های پیشرفته می‌تواند موجب افزایش کارایی انتخاب به کمک نشانگر و پیشبرد برنامه‌های به‌نژادی گیاهی شود. با‌توجه‌به نتایج پژوهش حاضر، پنج مکان‌ ژنی بزرگ‌اثر به‌ترتیب در شرایط طبیعی، تنش 12، 15 و 20 دسی‌زیمنس بر متر شناسایی شدند که بخش زیادی از واریانس فنوتیپی صفت‌های وزن خشک دانه، طول ساقه‌چه، قطر دانه و طول ریشه‌چه را توجیه کردند و ضریب تبیین مربوط به آنها به‌ترتیب برابر با 3/12، 4/14، 5/12، 8/12 و 4/15 درصد بود. از این مکان‌های ژنی می‌توان پس‌از تعیین اعتبار، در جمعیت‌های دیگر و برای اصلاح ارقام و درنهایت شناسایی ارقام متحمل به شوری استفاده کرد.

Caetano Anolles, G. and Gresshoff, P. M. (1994) Staining nucleic acids with silver: An alternative to radioisotopic and fluorescent labeling. Promege Notes Magazine 45: 13-21.

Collard, B. C. Y. and Mackill, D. J. (2008) Marker-assisted selection: An approach for precision plant breeding in the twenty first century. Philosophical Transactions of the Royal Society 363(1491): 557-572.

Colmer, T. D., Flowers, T. J. and Munns, R. (2006) Use of wild relatives to improve salt tolerance in Barley. Journal of Experimental Botany 57: 1059-1078.

Czyczyło- Mysza, I., Marcinska, I., Skrzypek, E., Cyganek, K., Juzon, K. and Karbarz, M. (2014) QTL Mapping for germination of seeds obtained from previous wheat generation under drought. Central European Journal of Biology 9: 374-382.

Etesami, M. V. and Galeshi, S. (2008) Evaluating the reaction of ten barley genotypes (Hordeum vulgare L.) Salinity at germination stage and seedling growth. Journal of Agricultural Sciences and Natural Resources 5: 39-46 (in Persian).

Fakheri, B. and Khalegh Babaki, A. (2014) Study of genomic area mapping controlling the physiological and morphological traits associated with germination of bread wheat. Iranian Journal of Field Crop Science 45(1): 119-133 (in Persian).

 

FAO, Food and Agriculture Organization. Retrieved from http://faostat.fao.org. On: 16 May 2013.

Flowers, T. J. (2004) Improving crop salt tolerance. Journal of Experimental Botany 55(396): 307-319.

Haley, C. S. and Knott, S. A. (1992) A simple regression method for mapping quantitative trait loci in line crosses using flanking markers. Heredity 69(4): 315-324.

Hussain, H., Al-Jaloud, A. A., Al-Shammary, S. A., Karimulla, S. and Al-Aswad, S. O. (1997) Effect of salineirrigation on germination and growth parameters of barley (Hordeum vulgare L.) in a pot experiment. Agricultural Water Management 34: 125-135.

Kaviani charati, A., Sabouri, H., Falahi, H. A. and Jorjani, E. (2017) QTL mapping of spike characteristics in Barley using F3 and F4 families derived from Badia × Komino cross. Journal of Plant Genetic Research 3(1): 13-28 (in Persian).

Kosambi, D. D. (1944) The estimation of map distances from recombination values. Annual Eugene 12(1): 172-175.

Khalili, M. and Mohammadi, S. A. (2015) Mapping QTLs associated with wheat seed germination under normal and drought stress conditions. Journal of Crop Biotechnology 5(9): 1-14.

Khalili, M., Javaheri Khashani, F. and Ebrahimi, M. A. (2017) Evaluation of genetic diversity and identification of QTL Controlling seed germination and seedling establishment traits in wheat. Iranian Agriculture Drought Journal 1: 121-145 (in Persian).

Liang, C., Lou, Q. J., Sun, Z. X., Xing, Y. Z., Yu, X. Q. and Luo, L. J. (2006) QTL mapping of low temperature on germination rate of rice. Rice Science 13: 93-98.

Maguire, J. D. (1962) Seed of germination aid in selection and evaluation for seedling emergence andvigour. Crop Science 2: 176-177.

Munns, R. and James, R. A. (2003) Screening methods for salt tolerance: A case study with tetraploid wheat. Plant and Soil 253: 239-250.

Miura, K., Lin, S. Y., Araki, H., Nagamine, T., Kuroki, M., Shimizu, H., Ando, L. and Yano, M. (2004) Genetical studies on germination of seed and seedling establishment for breeding of improved rice varieties suitable for direct seedling culture. Japan Agricultural Research Quarterly: JARQ 38: 1-5.

Mohamadi, S. (2003) Investigation of physiological aspects of production of cold wheat in saline lands. PhD thesis, Islamic Azad University of Science Research Unit, Tehran, Iran (in Persian).

Nelson, J. (1997) QGENE: Software for marker– based analysis and breeding. Molecular Breeding 3: 239-245.

Rabei, B., Mardani, Z., Ghomi, K., Sabori, H. and Sabori, A. (2014) The Effect of Rice Chromosome 1 on traits associated with drought and salinity tolerance at germination and seedling stages. Journal of Seed and Plant Seedlings 30: 1-16 (in Persian).

Sabouri, H., Biabani, A., Sabouri, A. and Mohammad Esmaili, M. (2010) The study of QTLs related to seed vigour under stress caused to Sorbitol in rice. Journal of Plant Production 17(2): 123-136 (in Persian).

Saghi Maroof, M. A., Biyaoshev, R. M., Yang, G. P., Zhang, Q. and Allard, R. W. (1994) Extra ordinarily polymorphic microsatellites DNA in barly: Speciesdiversity, chromosomal location, and population dynamics. Proceedings of the National Academy of Sciences of the United States of America 91: 5566-5570.

Shahraki, H., Fakheri, B. A. and Allahdou, M. (2013) Genimic regions mapping for some phonological traits associated with salt tolerance in doubled haploid lines of barley (Hordeum Vulgare L.). International Journal of Agriculture and crop science 67: 403-409 (in Persian).

Zhang, Z. H., Yu, S. B., Yu, T., Huang, Z. and Zhu, Y. G. (2005) Mapping quantitative trait loci (QTLs) for seedling vigor using recombinant inbred lines of rice (Oryza sativa L.). Field Crops Research 91: 161-170.