بررسی درون‌شیشه‌ای دو گونۀ سرخدار ازنظر تنوع اندوفیتی و تغییرات پاکلی‌تاکسل

نوع مقاله: مقاله پژوهشی

نویسندگان

1 گروه علوم باغبانیف دانشگاه علوم کشاورزی و منابع طبیعی گرگان

2 گروه گیاهپزشکی، دانشگاه علوم کشاورزی و منابع طبیعی گرگان

3 گروه علوم باغبانی، دانشگاه علوم کشاورزی و منابع طبیعی گرگان

10.22108/ijpb.2020.116513.1150

چکیده

امروزه با‌توجه‌به رشد کند گیاه سرخدار و اهمیت متابولیت‌های آن، اندوفیت‌های بیوسنتزکنندۀ ترکیبات ارزشمند سرخدار اهمیت پژوهشی زیادی یافته‌اند؛ به‌طوری‌که تولید پاکلی‌تاکسل در سلول گیاهی بدون اندوفیت غیرممکن تلقی می‌شود. در پژوهش حاضر سعی شده است علاوه‌بر بررسی تغییرات کیفی کالوس از نظر پاکلی‌تاکسل در شرایط درون‌شیشه‌‌ای، وضعیت اندوفیتی کالوس بررسی شود؛ به این منظور، آزمایشی با سه سطح 1، 2 و 3 میلی‌گرم‌در‌لیتر 2,4-D و دو سطح 5/0 و 2/0 میلی‌گرم‌در‌لیتر کینتین برای دو گونۀ سرخدار (Taxus baccata و Taxus brevifolia) طراحی و اجرا شد و درنهایت، میزان پاکلی‌تاکسل و وضعیت اندوفیت در کالوس بررسی شد. پس‌از گذشت 3 ماه از زمان کشت، قارچ‌های اندوفیت به تعداد 9 کلنی در کالوس ساقۀ هر دو گونه و برگ گونۀ T. baccata ظاهر شدند. قارچ‌ها بر اساس ریخت‌شناسی و نوع اندام زایشی مانند تشکیل هاگ و نوع هاگ شناسایی شدند. از میان اندوفیت‌های یافت‌شده، تنها Aspergillus flavus با ویژگی‌های شاخص کنیدی، سلول فیالید و کنیدیفور شناسایی شد و سایر نمونه‌های قارچی مشاهده‌شده فاقد اسپور بودند یا حالت پیکنیدیوم داشتند. اگرچه بررسی‌های مولکولی و بیوشیمیایی اندوفیت‌های جداسازی‌شده از کالوس توانایی تولید پاکلی‌تاکسل در آنها را نشان ندادند، ردیابی اندوفیت در کالوس سرخدار که برای نخستین‌بار گزارش می‌شود، نقطۀ عطفی در درک بهتر جایگاه میزبان و اندوفیت در تولید متابولیت ارزشمند پاکلی‌تاکسل به‌ویژه در کشت بافت است.
 

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

In vitro study of two species of yew tree in terms of endophytic diversity and paclitaxel variation

نویسندگان [English]

  • Arezoo Jondoaghleboob 1
  • Azim Ghasemnezhad 1
  • Kamran Rahnama 2
  • Mostafa Khoshhal Sarmast 3
1 Department of Horticultural Sciences, Gorgan University of Agricultural Sciences and Natural Resources
2 Department of phytopatology, Gorgan University of Agriculture and Natural Resources
3 Department of Horticultural Sciences, Gorgan University of Agriculture and Natural Resources
چکیده [English]

Due to the slow growth of the yew tree and importance of its metabolites, today, the paclitaxel producing endophytes have been found to be of great research interest. To that extent, in no presence of endophyte, the production of taxol in plant is not possible. In the present study, it has been tried beside the investigation of the qualitative changes of callus from the point of paclitaxel, the endophytic situation of it also be studied. For this purpose, an experiment was conducted with three levels of 1, 2 and 3 mg/L of 2, 4-D, and two levels of 0.5 and 0.2 mg/L of Kinetin in two species of T.baccata and T.brevifolia. Finally, the amount of paclitaxel and the endophytic status in callus were studied. After 3 months of cultivation, 9 colonies of the endophytic fungi appeared in the callus of both species and leaves of T.baccata. The isolated fungi were identified based on their morphology and reproductive organs, such as the formation of spores. Although molecular and biochemical studies of isolated endophytes did not show the ability to produce taxol in them, endophytic fungi in the yew callus, which was first reported, could be a turning point in a better understanding of host and endophytic fungi in the production of valuable metabolites of paclitaxel, especially in cell and hairy root cultures.
 

کلیدواژه‌ها [English]

  • Endophyte
  • Taxol
  • Tissue culture
  • Yew

مقدمه.

درخت سرخدار (Taxus baccata L.) متعلق به تیرۀ سرخدار (Taxaceae) و از گونه‌های باارزش سوزنی‌برگان نادر و در خطر انقراض بومی جنگل‌های شمال ایران است. مطالعه‌های فسیل‌شناسی نشان می‌دهند قدمت درختان سرخدار بالغ بر 190 میلیون سال است و قدیمی‌ترین فسیل سرخدار به دوره‌های میوسن و پلیوسن تعلق دارد؛ در دوره‌های بعد، توده‌های آمیختۀ درختان سرخدار با گونه‌های راش و ممرز شکل گرفتند (Mossadegh, 1993). تیرۀ سرخدار سه جنس دارد (Mossadegh, 1993): جنس Austrotaxus در جنگل‌های مرطوب کالدونی رشد می‌کند و بومی این سرزمین است؛ جنس Torreya 5 گونه دارد که 3 گونۀ آن در شرق آسیا و دو گونۀ آن در آمریکای شمالی وجود دارند؛ جنس Taxus شامل 8 گونه است که در نیمکرۀ شمالی، اروپا، آسیا و آمریکای شمالی پراکنده‌اند (Itokawa and Lee, 2002).

تاکسان‌ها ترکیبات اصلی سرخدار را تشکیل می‌دهند (Wani et al., 1971; Miller and Brief, 1980; Woods et al., 1996). بیش از 350 تاکسان (مشتقات دی‌ترپنوئید) در گونه‌های مختلف تشخیص داده شده‌اند که تاکسل مهم‌ترین آنهاست (Evans, 2002). تاکسل، آلکالوئیدی گیاهی با ساختار شیمیایی بسیار پیچیده است که یکی از مؤثرترین داروهای ضدسرطان و از محبوب‌ترین داروها برای استفاده در شیمی‌درمانی به شمار می‌آید (Expósito et al., 2009). تاکسل در برابر گسترۀ وسیعی از انواع تومورها ازجمله سرطان سینه، رحم، معده و سر و گردن مؤثر است و عامل ضدمیکروتوبولی فعال در برابر سارکومای کاپوزیس (Kaposi’s sarcoma) وابسته به ایدز شناخته شده است (Strobel et al., 1996)؛ این ترکیب با اتصال به میکروتوبول‌ها سبب افزایش تجمع و اتصال توبولین‌ها و به دنبال آن، تشکیل میکروتوبول‌های پایدار می‌شود (Baloglu and Kingston, 1999).

تولید انبوه و سریع مواد مؤثره از روش‌های شیمیایی عمدتاً مشکل یا غیرممکن است و از سویی، محدودیت‌های مختلف مانع تأمین این ترکیبات از طبیعت می‌شوند. استفاده از راهکارهای زیست‌فناوری ازجمله کشت سوسپانسیون سلولی و کشت کالوس، راه حل مناسبی برای تولید سریع و انبوه متابولیت‌های ثانویه است (Bourgaud et al., .2002; Rao and Ravishankar, 2002; Sinha and Vidyarthi, 2011). کشت سلول‌های گیاهی منبع مناسب و مهمی برای تولید متابولیت‌های ثانویۀ با‌ارزش در بیشتر گیاهان است (Sinha and Vidyarthi, 2011). کالوس، تودۀ سلولی کم‌‌و‌بیش سازمان‌نیافته با دیوارۀ سلولی نازک است که معمولاً از سلول‌های پارانشیمی به وجود می‌آید. نخستین‌بار در سال 1971، تاکسل از پوست درخت T. brevifolia جداسازی و استخراج شد. این ترکیب در تمام بخش‌های گیاه سرخدار به‌جز میوۀ تازۀ آن وجود دارد و مقدار آن تحت‌تأثیر نوع اندام و گونۀ گیاهی متفاوت است. مقدار تاکسل در گونۀ T. baccataبرابر02/0درصد وزن خشک گیاه و در گونۀ T.brevifoliaبرابر01/0 درصد وزن خشک گیاه است (Yarikhosroshahi, 2004). ازآنجاکه تولید 1 کیلوگرم تاکسل از گیاه مستلزم قطع 2000 تا 2500 اصله درخت سرخدار بالغ است و بیمار سرطانی در طول درمان خود به 6 درخت نیاز دارد، تولید تاکسل از این منبع طبیعی سبب قطع بی‌رویه و انقراض درختان سرخدار می‌شود. طی دهۀ اخیر، پژوهشگران در پی یافتن راه‌های جدید برای بهترکردن شرایط تولید و کاهش قیمت این داروی باارزش به‌منظور پاسخگویی به نیاز بیماران سرطانی و کلینیک‌های تخصصی بوده‌اند (Jennewein and Croteau, 2001). برخی از اندوفیت‌ها توانایی تولید تاکسل را دارند. تلاش‌ها برای شناسایی ریزموجودات همزیست سرخدار به کشف قارچ‌‌های تولید‌کنندۀ پاکلی‌تاکسل منجر شده‌اند (Lesani, 1999; Wang et al., 2000). شناسایی قارچ‌های اندوفیت گیاهان چوبی و چندساله و مطالعۀ برهم‌کنش آنها با گیاهان میزبان کمتر از قارچ‌های اندوفیت گیاهان دیگر مدنظر قرار گرفته است (Weber, 2009). .برخی از قارچ‌های اندوفیت درختان سرخدار به‌علت داشتن توانایی تولید داروی ضدسرطان پاکلی‌تاکسل، منبع تجدیدشوندۀ مهمی برای تولید این داروی باارزش و گران‌قیمت محسوب می‌شوند. باوجود مطالعه‌های بسیاری که در زمینۀ این گروه از قارچ‌ها در دنیا انجام شده‌اند، تاکنون پژوهشی در زمینۀ امکان جداسازی اندوفیت از کالوس و توانمندی قارچ‌های اندوفیت حاصل از کالوس سرخدار انجام نشده است؛ ازاین‌رو، مقالۀ حاضر بخشی از نتایج پژوهش انجام‌شده به‌منظور شناسایی قارچ‌های اندوفیت حاصل از کالوس دو گونۀ سرخدار را ارائه می‌دهد.

مواد و روش‌ها.

تهیۀ ریزنمونۀ سرخدار از دو گونه: ساقه‌های جوان و بدون آلودگی درختان بالغ گونۀ T. baccata واقع در روستای زیارت گرگان و گونۀ T. brevifolia واقع در باغ گیاه‌شناسی نوشهر استان مازندران طی تیرماه 96 در پاکت‌های کاغذی به آزمایشگاه منتقل شدند. نمونه‌های گیاهی تا زمان کشت، در یخچال و درون پارچۀ نخی خیس نگهداری شدند. به‌منظور انتخاب ریزنمونه‌ها از ساقه‌های مناسب و قوی به طول 5 سانتی‌متر استفاده شد. ساقه‌های منتخب با آب حاوی چند قطره مایع ظرفشویی به‌مدت 10 دقیقه شستشو شدند و سپس برای حذف بقایای اضافی، نمونه‌ها چند مرتبه با آب روان شستشو و بی‌درنگ به دستگاه لامینار ایرفلوی استریل منتقل شدند. بهترین ضدعفونی ریزنمونه‌ها با الکل 70 درصد به‌مدت 15 ثانیه و هیپوکلرید‌سدیم حاوی 5 درصد کلر فعال با یک قطره مایع ظرفشویی به‌مدت 25 دقیقه انجام شد؛ درنهایت، ریزنمونه‌هایی به‌اندازۀ 1 سانتی‌متر از اندام‌های گیاهی ضدعفونی‌شده تهیه و در محیط‌کشت Gamborg (B5) با شش سطح هورمونی ترکیبی 2,4-D و کینتین شامل غلظت‌های 1، 2 و 3 میلی‌گرم‌در‌‌لیتر 2,4-D و 2/0 و 5/0 میلی‌گرم‌در‌لیتر کینتین و سه تکرار با رعایت شرایط استریل کشت شدند و به اتاق رشد با دمای 24 تا 26 درجۀ سانتی‌گراد و شرایط نوری 16 ساعت روشنایی و 8 ساعت تاریکی انتقال یافتند..

.کشت کالوس در محیط Potato Dextrose Agar: پس‌از گذشت 28 روز از رشد کالوس در تیمارهای استفاده‌شده و برای بررسی وضعیت کالوس ازنظر وجود اندوفیت قارچی، مقداری کالوس‌ در شرایط کاملاً استریل به محیط PDA منتقل شد. به‌منظور ظهور اندوفیت‌های احتمالی، نمونه‌های کشت‌شده به انکوباتوری با دمای 24 درجۀ سانتی‌گراد منتقل و تا زمان ظهور اندوفیت در آن نگهداری شدند. بر اساس منابع، نمونه‌های قارچی که حداقل 10 روز پس از کشت لزوماً از روی نمونه ظاهر می‌شوند، اندوفیت تلقی می‌شوند. پس‌از رشد مناسب نمونه‌های اندوفیت، نوک هیف قارچ‌های رشدیافته از کالوس جدا و به محیط‌کشت PDA منتقل شد و به‌منظور اطمینان‌یافتن از خلوص قارچ‌های اندوفیت به‌دست‌آمده، این عمل دو بار دیگر نیز تکرار شد (Zhang et al., 2008).

طراحی آغازگرها و بررسی بیوانفورماتیکی آغازگرهای استفاده‌شده: مطابق جدول 1، سه آغازگر برای تکثیر سه ژن DAPT (10-deacetylbaccatin III-10-O-acetyl transferase)، BAPT (Baccatin-aminophenylpropanoyl-13-O-transferase) و TS (Taxadiene synthase) استفاده شدند.

 

 

جدول 1- آغازگرهای استفاده‌شده برای ردیابی ژن‌های درگیر در بیوسنتز تاکسل در کالوس سرخدار و اندوفیت‌های جداسازی‌شده

Annealing temperature

Primer name

Sequence (5´-3´)

Product length (bp)

60/57

53/57

DAPT F:

DAPT R:

GGGAGGGTGCTCTGTTTG

GTTACCTGAACCACCAGAGG

153

75/59

88/59

BABT F:

BABT R:

CCTCTCTCCGCCATTGACAA

TCGCCATCTCTGCCATACTT

631

96/58

59/59

TS F:

TS R:

AAACCCATGTCGAATTGAGAAG

CAAGTTTGCATACACTCTGGAATCT

1070

 


.استخراج DNA ژنومی و انجام واکنش زنجیره‌ای پلیمراز (PCR):به‌منظور استخراج DNA قارچ‌های جداسازی‌شده، میسلیوم‌ها با نیتروژن مایع کاملاً پودر شدند و استخراج DNA به روش CTAB .(Cetyl trimethylammonium bromide) انجام شد؛ DNA سرخدار برای شاهد مثبت در واکنش PCR استفاده شد. مقدار 5/0 گرم کالوس سرخدار با استفاده از نیتروژن مایع ساییده و استخراج DNA ژنومی به روش یادشده انجام شد. آغازگرهای اختصاصی که ناحیۀ حفاظت‌شده‌ای از ژن‌های مدنظر را تکثیر می‌کنند (جدول 1)، به‌منظور بررسی حضور ژن‌های DBAT، BAPT و TS در قارچ‌ها استفاده شدند. حجم نهایی هر واکنش 20 میکرولیتر حاوی 10 نانوگرم DNA، 2 میکرولیتر بافر x PCR 10، 7/0 میکرولیتر کلریدمنیزیم (50 میلی‌مولار)، 5/0 میکرولیتر dNTPs 10 میلی‌مولار، 1 میکرولیتر از آغازگر‌ها و 3/0 میکرولیتر Taq DNA polymerase (سیناژن، ایران) بود. مخلوط حاضر پس‌از افزودن آب دوبار تقطیر استریل به حجم 20 میکرولیتر رسانده شد و در PCR با برنامۀ زیر قرار داده شد: واسرشت‌شدن ابتدایی به‌مدت 2 دقیقه در دمای 95 درجۀ سانتی‌گراد، سپس 30 چرخۀ واکنش در 95 درجۀ سانتی‌گراد به‌مدت 30 ثانیه، 8/52 درجۀ سانتی‌گراد به‌مدت 30 ثانیه و72 درجۀ سانتی‌گراد به‌مدت 30 ثانیه و درنهایت،گسترش نهایی در 72 درجۀ سانتی‌گراد به‌مدت 10 دقیقه.

الکتروفورز نمونه‌ها: به‌منظور تفکیک قطعه‌های DNA و آگاهی از محصولات PCR و ‌مشاهده‌پذیر‌کردن آنها، الکتروفورز محصول PCR نمونه‌ها به‌‌مدت 45 دقیقه روی ژل آگارز (KIA GEN، ایران) انجام شد (Zhang et al., 2008). بافر TBE شامل EDTA 5/0 مولار، بوریک‌اسید و آب مقطر دیونیزه با اسیدیتۀ 8 برای ساخت ژل آگارز 2 درصد و مادۀ رنگی safe dye شرکت سیناژن برای رنگ‌آمیزی ژل استفاده شد.

عصاره‌گیری و تعیین میزان پاکلی‌تاکسل نمونه‌ها با استفاده از HPLC: به‌منظور استخراج و تعیین مقدار پاکلی‌تاکسل از روش پیشنهادی Ghassempour (2009) استفاده شد؛ به این منظور، ابتدا 2 گرم کالوس تازه کاملاً ساییده‌ و در 100 میلی‌لیتر متانول خیسانده شد؛ سپس به‌منظور نفوذ کامل حلال، نمونه به‌مدت 24 ساعت در دمای اتاق روی شیکر قرار گرفت. پس‌از صاف‌کردن عصارۀ متانولی، آب به مقداری برابر با حجم متانول به آن اضافه و سپس، 20 میلی‌لیتر ان‌هگزان در قیف دکانتور به نمونه افزوده شد. پس‌از حذف ان‌هگزان، 20 میلی‌لیتر دی‌کلرومتان به عصارۀ متانولی در قیف دکانتور اضافه شد و پس از تبخیر حلال به کمک تبخیرکنندۀ دوار، مادۀ خشک به‌دست‌آمده در استونیتریل خالص حل و تا زمان تجزیه‌وتحلیل در فریزر نگهداری شد.

اندازه‌‌گیری میزان پاکلی‌تاکسل نمونه‌های ساقه و برگ گونۀ T. brevifolia و ساقۀ گونۀ T. baccataبا استفاده از HPLC (مدل Merck-Hitachi، آلمان) مجهز به ستون C18 با ابعاد 6/4×250 میلی‌متر انجام شد. فاز متحرک شامل متانول، استونیتریل و آب به نسبت 40: 4: 20 میلی‌لیتر بود که با شدت جریان 1 میلی‌لیتربر‌دقیقه در طول موج 230 نانومتر انجام شد. نمونه پیش‌ از تزریق، دو مرتبه با فیلتر 42/0 میکرون صاف شد. غلظت‌های مختلف پاکلی‌تاکسل خالص برای به‌دست‌آوردن منحنی کالیبراسیون استفاده شدند و سپس با قراردادن عدد سطح زیر پیک هر نمونه، میزان پاکلی‌تاکسل محاسبه و مقدار آن بر حسب میکرو‌گرم‌در‌گرم گزارش شد.

تجزیه‌وتحلیل آماری داده‌ها: پژوهش حاضر با آرایش فاکتوریل بر پایۀ طرح کاملاً تصادفی و در شش تیمار و سه تکرار انجام شد. تیمارهای آزمایش شامل سه سطح 2,4-D (1، 2 و 3 میلی‌گرم‌در‌لیتر) و دو سطح کینتین (2/0 و 5/0 میلی‌گرم‌در‌لیتر) بودند. تجزیه‌وتحلیل آماری داده‌ها با نرم‌افزار آماری SPSS نسخۀ 16 انجام و آزمونLSD در سطح 5 درصد برای مقایسۀ میانگین داده‌ها استفاده شد. نرم‌افزار Excel نسخۀ 2010 برای رسم نمودار استفاده شد.

 

نتایج و بحث

بررسی صفت‌های ریخت‌شناختی کالوس ساقه و برگ دو گونۀ سرخدار: کالوس ازنظر رنگ تا چهار هفتۀ اول پس‌از کالوس‌دهی سبزرنگ بود و پس‌از این مدت، نمونه‌های کالوس زیرکشت‌ شدند و به‌منظور جلوگیری از قهوه‌ای‌شدن، زغال فعال (200 میلی‌گرم‌در‌لیتر) به محیط جدید با شرایط هورمونی قبلی اضافه شد. رنگ اغلب کالوس‌ها در تمام سطوح تیماری تقریباً قهوه‌ای مایل به نارنجی بود.

ازنظر سفتی بافت، کالوس‌های حاصل در تمام سطوح تیماری دارای بافت نرم بودند. ازآنجاکه کیفیت کالوس به نوع و مقدار عناصر (ماکرو، میکرو، ویتامین‌ها و ...) موجود در محیط‌کشت وابسته است، محیط‌کشت و تنظیم‌کننده‌های مختلف رشد بر این متغیر تأثیر می‌گذارند. گزارش شده است کالوس‌ در محیط‌کشت‌های حاوی غلظت اندک کینتین و غلظت زیاد 2,4-D رشد سریعی دارد و ساختار کالوس نرم و سست است (Karimian et al., 2015)؛ نکته‌ای که در پژوهش حاضر نیز مشاهده شد. به‌طورکلی، ریزنمونۀ گونۀ T. baccata قابلیت بیشتری برای تشکیل کالوس از خود نشان می‌دهد و ازجمله دلایل این اختلاف عبارتند از: متفاوت‌بودن رویشگاه و شرایط جغرافیایی و محیطی رویشگاه گونه‌های استفاده‌شدۀ Taxus.

جداسازی قارچ‌های اندوفیت از کالوس ساقۀ دو گونۀ سرخدار: اغلب گیاهانی که تاکنون در اکوسیستم‌های طبیعی مطالعه شده‌اند، با گروهی از قارچ‌ها کلونیزه می‌شوند که نشانه‌های ظاهری مشخصی را در گیاهان ایجاد نمی‌کنند و به آنها اندوفیت گفته می‌شود (Schulz and Boyle, 2006; Hyde and Soytong, 2008). پس‌از گذشت بیش از سه هفته از کشت کالوس ساقه و برگ دو گونۀ مطالعه‌شده، قارچ اندوفیت از روی کالوس در محیط‌کشت PDA ظاهر شد. تعداد 9 کلنی قارچ اندوفیت از هر دو گونه جداسازی شد که ازنظر ویژگی‌های ریخت‌شناختی ازجمله شکل کلنی، رنگ، حاشیۀ کلنی، شکل هاگ‌های غیرجنسی مانند ساختار کنیدی و کنیدیفور و سرعت رشد کاملاً باهم متفاوت بودند (شکل‌های 1 تا 6).

قارچ‌های رشدکرده از کالوس: ظهور اندوفیت از کالوس‌های یک‌ماهه، دو‌ماهه و سه‌ماهه در محیط B5 و همچنین در محیط PDA مشاهده شد. همان‌‌طور که در جدول 2 و شکل 1 آمده است، تمام قارچ‌ها بدون استثنا از کالوس ظاهر شدند و رشد آنها کند بود که از مشخصه‌های مهم قارچ‌های اندوفیت است. از 9 کلنی قارچی مشاهده‌شده، 4 کلنی از ساقۀ T. baccata، 1 کلنی از برگ T. baccata و 4 کلنی از ساقۀ T. brevifoli جداسازی شدند.


 

جدول 2- قارچ‌های شناسایی‌شده از کالوس ساقه و برگ هر دو گونۀ سرخدار

Aspergillus flavus

این کلنی در 4 کالوس با تیمارهای هورمونی مختلف از ساقۀ گونۀ T.baccata مشاهده شد.

میسیلیوم عقیم

از برگ گونۀ T.baccata

Paraphoma sp

این کلنی در 4 کالوس با تیمارهای هورمونی مختلف از ساقۀ گونۀ T. brevifolia به‌شکل پیکنیدیوم مشاهده شد.

 

 

شکل 1- ظهور اندوفیت قارچی از کالوس دو گونۀ سرخدار در شرایط درون‌شیشه‌ای؛ شمارۀ1.قارچرشد‌کردهازکالوسبرگT. baccata، شماره‌های2و3.قارچرشد‌کردهازکالوسساقۀ T. baccataباتیمارهایهورمونی مختلف،شماره‌های4،5و6. قارچرشدکردهازکالوسساقۀT. brevifoliaباتیمارهایهورمونی مختلف


.قارچ‌های جداسازی‌شده از کالوس گونۀ T. baccata در محیط PDA: قارچ‌های اندوفیت رشدکرده از کالوس T. baccata طی سه مرحله به روش نوک هیف روی محیط PDA خالص‌سازی شدند. در شکل 2، تصاویر ماکروسکوپی نمونه‌های قارچی جداسازی‌شده از T. baccata آمده است.شناسایی نمونه بر اساس بررسی‌های ریخت‌شناختی و تطبیق با کلید Ellis (1971) انجام شد. در شناسایی اولیۀ این قارچ‌ها که باتوجه‌به ویژگی‌های ریخت‌شناختی و تصاویر ماکروسکوپی آنها انجام شد، بخش اعظمی از آنها به Aspergillus flavus تعلق یافتند.

 

 

 

شکل 2- قارچ‌های خالص‌سازی‌شده از ساقه و برگ گونۀ T. baccata؛ 1. قارچ رشد‌کرده در تیمار 1 میلی‌گرم‌درلیتر 2,4-D و 5/0 میلی‌گرم‌درلیتر کینتین از ریزنمونۀ ساقه، 2. قارچ رشد‌کرده در تیمار 3 میلی‌گرم‌درلیتر 2,4-D و 5/0 میلی‌گرم‌درلیتر کینتین از ریزنمونۀ ساقه، 3. قارچ رشد‌کرده در تیمار 2 میلی‌گرم‌درلیتر  2,4-Dو 2/0 میلی‌گرم‌درلیتر کینتین از ریزنمونۀ برگ، 4. قارچ رشد‌کرده در تیمار 3 میلی‌گرم‌درلیتر 2,4-D و 2/0 میلی‌گرم‌درلیتر کینتین از ریزنمونۀ ساقه، 5. قارچ رشد‌کرده در 1 میلی‌گرم‌درلیتر 2,4-D و 2/0 میلی‌گرم‌درلیتر کینتین از ریزنمونۀ ساقه

 


Aspergillus flavus: کلنی آسپرژیلوس جداسازی‌شده از کالوس ساقۀ T. baccata(شکل 3) روی محیط‌کشت PDA در دمای 25 درجۀ سانتی‌گراد به رنگ سبز مشاهده شد. کنیدیفورها به‌طور عمودی منفرد از میسلیوم خارج شده بودند و در نزدیکی نوک انشعاب داشتند. کنیدیفورها به‌طور ماکرونماتوس و دارای سلول پایۀ کنیدیفور با ابعاد 1 تا 5/1 میلی‌متر بودند. کنیدیفورها صاف و بی‌رنگ بودند و گاهی اوقات در نوک قهوه‌ای‌رنگ، وزیکول‌های کروی یا گرزی‌شکل به ابعاد 20 تا 50 میکرومتر داشتند. کنیدیوم‌ها تک‌سلولی، گرد، آکروژن و به‌‌شکل توده‌های رنگی متفاوت در زنجیره‌های پاسیپتال و صاف تا زبر مشاهده شدند.

میسیلیوم عقیم: میسیلیوم عقیم جداشده از کالوس برگ گونۀ T. baccata (شکل 4) روی محیط‌کشت PDA به رنگ سفید و پنبه‌ای، دارای رشد سریع، در برخی مناطق نازک، شفاف و سفید مشاهده شد. میسیلیوم دارای دیوارۀ نازک، شفاف، منشعب و به قطر 2 تا 8/4 میکرومتر بود و اسپوری روی محیط‌کشت مشاهده نشد.

قارچ‌های جداسازی‌شده از کالوس گونۀT. brevifolia در محیط PDA: قارچ‌های اندوفیت رشد‌کرده از کالوس گونۀ T. brevifolia طی سه مرحله به روش نوک هیف روی محیط PDA خالص‌سازی شدند. در شکل 5، تصاویر ماکروسکوپی نمونه‌های قارچی جداسازی‌شده از گونۀ T. brevifolia آمده است.شناسایی نمونه بر اساس بررسی‌های ریخت‌شناختی و تطبیق با کلید Ellis (1971) انجام شد. در شناسایی اولیۀ این قارچ‌ها که باتوجه‌به ویژگی‌های ریخت‌شناختی و تصاویر ماکروسکوپی آنها انجام شد، همۀ قارچ‌های جداسازی‌شده از این گونۀ سرخدار حالت پیکنیدیوم داشتند.

 

 

 

شکل 3- 1. کلنی قارچ Aspergillus flavus روی محیط‌کشت PDA، 2. مشاهدۀ کنیدیفور، 3. کنیدیوم با بزرگ‌نمایی 400×

 

 

شکل 4- 1. کلنی قارچ روی محیط‌کشت PDA، 2. هیف

 

 

شکل 5-قارچ‌هایجدا‌سازی‌شدهازکالوسساقۀگونۀT. brevifolia؛ 1. قارچ رشد‌کرده در تیمار 2 میلی‌گرم‌درلیتر 2,4-D و 5/0 میلی‌گرم‌درلیتر کینتین از ریزنمونۀ ساقه، 2. قارچ رشد‌کرده در تیمار 1 میلی‌گرم‌درلیتر  2,4-Dو 5/0 میلی‌گرم‌درلیتر کینتین از ریزنمونۀ ساقه، 3: قارچ رشد‌کرده در تیمار 2 میلی‌گرم‌درلیتر 2,4-D و 2/0 میلی‌گرم‌درلیتر کینتین از ریزنمونۀ ساقه، 4. قارچ رشد‌کرده در تیمار 3 میلی‌گرم‌درلیتر 2,4-D و 5/0 میلی‌گرم‌درلیتر کینتین از ریزنمونۀ ساقه


Paraphoma sp.:جمعیت غالب قارچی جداسازی‌شده از کالوس گونۀ T. brevifolia از نوع پیکنیدیوم بود. اندوفیت جداسازی‌شده از کالوس ساقۀ گونۀT. brevifoliaدر محیط‌کشت PDA پس‌از گذشت 14 روز به رنگ طوسی خاکستری با کنیدیوم‌های شفاف و به رنگ روشن، تک‌سلولی، استوانه‌ای‌شکل و به طول 5/4 تا 5/5 میکرومتر و عرض 5/1 تا 2 میکرومتر مشاهده شد. پیکنیدیوم‌ها به رنگ قهوه‌ای تیره، گلابی‌شکل، دارای دیوارۀ سودوپارانشیمی و به عرض 150 تا 350 و طول 157 تا 355 میکرومتر بودند (Boerema et al., 2004).

 

 

 

شکل 6- 2، 4 و 6. کلنی قارچ اندوفیت روی محیط PDA، 1 و 3. پیکنیدیوم بالغ، 5. پیکنیدیوم نارس

 


ردیابی ژن‌های مرتبط با بیوسنتز پاکلی‌تاکسل در قارچ‌های اندوفیت جداسازی‌شده: همان‌طور که در شکل 7 دیده می‌شود، قارچ‌های اندوفیت جداسازی‌شده از کالوس دارای ژ‌‌ن‌های دخیل در بیوسنتز پاکلی‌تاکسل نبودند. نبود امکان ردیابی تاکسل در نمونه‌های اندوفیتی جداسازی‌شده در پژوهش حاضر بیان‌کنندۀ غیرمولد‌بودن اندوفیت‌های جداسازی‌شده است؛ هرچند اندوفیت‌ها بر حسب وظایف متفاوتی که در گیاه میزبان دارند، تقسیم‌بندی می‌شوند و صِرف اندوفیت‌بودن، دلیلی بر مولدبودن آنها نیست؛ نکته‌ای که در بررسی‌های قبلی نیز به آن اشاره شده است (Zhang et al., 2008).  

 

500 bp

631 bp

10

9

8

6

7

5

4

3

2

1

L

شکل 7- ژن bapt؛ L. خط‌کش زیستی، 1 و 2. DNA استخراج‌شده از نمونۀ گیاهی، 3 و 4. DNA استخراج‌شده از کالوس برگ گونۀ T. baccata،5. DNA استخراج‌شده از کالوس برگ گونۀ T. brevifolia، 6 تا10. DNA استخراج‌شده از قارچ‌های اندوفیت حاصل از کالوس

 

500 bp

L

1

2

3

4

5

6

7

9

8

10

شکل 8- ژن bapt؛ L. خط‌کش زیستی، 1 و 2. DNA استخراج‌شده از نمونۀ گیاهی، 3 و 4. DNA استخراج‌شده از کالوس برگ گونۀT. baccata، 5. DNA استخراج‌شده از کالوس برگ گونۀ T. brevifolia،6 تا10. DNA استخراج‌شده از قارچ‌های اندوفیت حاصل از کالوس

 

1070 bp

500 bp

7

5

4

1

6

3

L

8

9

10

2

شکل 9- ژن TS؛ L. خط‌کش زیستی، 1 و 2. DNA استخراج‌شده از نمونۀ گیاهی، 3. DNA استخراج‌شده ازکالوس برگ گونۀ T. baccata، 4. DNAاستخراج‌شده از کالوس ساقۀ گونۀ T. baccata. 5، DNA استخراج‌شده از کالوس برگ گونۀ T. brevifolia،6 تا10. DNA استخراج‌شده از قارچ‌های اندوفیت حاصل از کالوس


اندازه‌گیری پاکلی‌تاکسل: با تجزیه‌وتحلیل کروماتوگرام حاصل از HPLC، کالوس ساقۀ گونه‌های T. baccata و T. brevifolia و محاسبۀ داده‌های مرتبط، اختلاف معنا‌داری بین ساقه و برگ گونۀ T. brevifolia مشاهده نشد. میزان پاکلی‌تاکسل ساقه 9/6 و میزان ‌آن در برگ 1/10 میکروگرم‌برگرم بود. میزان پاکلی‌تاکسل موجود در کالوس گونۀ T. baccata4/33میکرو‌گرم‌برگرم وبیشتر از ساقه و برگ گونۀ T. brevifoliaبود (شکل 11). Ahadi و همکاران (2013) بیان کردند گونۀ T. baccata توانایی بیشتری در تولید پاکلی‌تاکسل نسبت به گونۀ T. brevifolia دارد که با نتایج پژوهش حاضر مطابقت دارد.

باتوجه‌به اینکه سرعت تولید متابولیت‌های ثانویه در طبیعت تحت‌تأثیر عوامل مختلفی قرار دارد، استفاده از روش‌های زیست‌فناوری در شرایط درون‌شیشه‌ای موقعیتی را فراهم می‌کند تا تولید در شرایط کنترل‌شده و زمان کمتر انجام شود (Shirazi et al., 2013)؛ در این زمینه، توسعۀ سیستم‌های سریع کشت و تکثیر درون‌شیشه‌ای فرصت بی‌نظیری برای تولید محصولات مختلف متابولیت ثانویه در آزمایشگاه و بدون نیاز به محدودیت زمانی، زمین‌ قابل‌کشت و عرصه‌های جنگل‌کاری است. اصولاً ساده‌ترین روش دستیابی به پاکلی‌تاکسل، استخراج آن از منابع گیاهی‌ است (Khosroushahi et al., 2006).

درختان چندساله برای استخراج پاکلی‌تاکسل مناسبند، اما محدودبودن تعداد درختان و کم‌بودن عملکرد این روش به‌علت مقدار اندک پاکلی‌تاکسل موجود در آنها به نابودی این منابع گیاهی منجر می‌شود (Khosroushahi et al., 2006)؛ از‌این‌رو، کشت بافت و سلول سرخدار و اندوفیت‌های مولد پاکلی‌تاکسل آن از مهم‌ترین روش‌های تولید پاکلی‌تاکسل به شمار می‌آید (Abasi et al., 2011)؛ زیرا جداسازی پاکلی‌تاکسل و دیگر تاکسوئیدهای مفید از کشت سلولی گیاه سرخدار نسبت به جداسازی آنها از بافت‌های طبیعی به مراحل کمتری نیاز دارد و میزان ترکیبات تداخل‌کننده در سلول‌های حاصل از کشت سلولی کمتر است (Ketchum and Croteau., 1998).

 

 

   

شکل10-منحنیکالیبراسیونحاصلازتزریقاستانداردتاکسل(راست)،کروماتوگرامحاصلازتزریقاستانداردپاکلی‌تاکسل(چپ)

 

شکل 11- نتایج مقایسه میانگین میزان پاکلی‌تاکسل در کالوس نمونه‌های برگ گونۀ T. brevifolia و ساقۀ گونه‌های T. baccata و T. brevifolia در سه تکرار. حرف‌های مشابه، وجودنداشتن تفاوت معنادار بین سطوح تیماری را در سطح 5 درصد نشان می‌دهند.

 


جمع‌بندی

از 9 اندوفیت یافت‌شده، تنها A. flavus با ویژگی‌های شاخص کنیدی، سلول فیالید و کنیدیفور شناسایی شد و سایر نمونه‌های قارچی مشاهده‌شده اسپور نداشتند یا حالت پیکنیدیوم داشتند. ردیابی اندوفیت در کالوس سرخدار که برای نخستین‌بار گزارش می‌شود، نقطۀ عطفی در درک بهتر جایگاه میزبان و اندوفیت در تولید متابولیت ارزشمند پاکلی‌تاکسل است.باتوجه‌به ارزش دارویی زیاد پاکلی‌تاکسل و هزینۀ زیاد تهیۀ آن برای بیماران سرطانی، شناسایی منابع جدید ضروری به نظر می‌رسد.

 

سپاسگزاری

از معاونت محترم پژوهشی دانشگاه علوم کشاورزی و منابع طبیعی گرگان برای فراهم‌کردن امکانات لازم برای پژوهش حاضر سپاسگزاری می‌شود.

Abasi, A., Mofid, M. and Otreshi, M. (2011) Study of the effect of base culture medium on the production of Taxus baccata L. anticancer drug in culture of yeast cell suspension. Journal of Plant Breeding 12(4): 83-88 (in Persian).
Ahadi, H., Mirjalili, M. H., Farzaneh, M., shirshekan, M. and Ghassempour, A. (2013) Quantification of taxol in wild mature and in vitro cell suspension cultures of Taxus baccataand Taxus berevifolia. 2th National Congress on Medicinal Plants, Tehran, Iran (in Persian).
Baloglu, E. and Kingston, D. G. (1999) The taxane diterpenoids. Journal of Natural Products 62(10): 74-1448.
Boerema, G. H., de Gruyter, J., Noordeloos, M. E. and Hamers, M. E. C. (2004) Phoma identification manual differentiation of specific and infra- specific taxa in culture. CABI Pub.
Bourgaud, F., Gravot, A. and Goniter, E. (2002) Production of plant secondary metabolites. Plant Science 161: 839-851.
 
Ellis, M. B. (1971) Dematiaceous Hyphomycetes. Commonwealth Mycological Institute, Kew, Surrey, England.
Evans, W. C. (2002) Trease and evans pharmacognosy. W. B. Saunders, Edinburgh, London, New York.
Expósito, O., Bonfill, M., Moyano, E., Onrubia, M., Mirjalili, M., Cusido, R. and Palazon, J. (2009) (2009) Biotechnological production of taxol and related taxoids: current state and prospects. Anticancer Agents in Medicinal Chemistry- Anti Cancer Agents 9(1): 109-121.
Ghassempour, A., Rezadoost, H., Ahmadi, M. and Aboul-Enein, H. Y. (2009) Seasons study of four important taxanes and purification of 10-deacetylbaccatin III from the needles of Taxus baccata L. by two-dimensional liquid chromatography. Journal of Liquid Chromatography and Related Technologies 32(10): 1434-144
Hyde, K. D. and Soytong, K. (2008) The fungal endophyte dilemma. Fungal Diversity 33: 163-173.
Itokawa, H. and Lee, K. H. (2002) Taxus: the genus Taxus. Taylor and Francis, London and New York.
Jennewein, S. and Croteau, R. (2001) Taxol biosynthesis, molecular genetics and biotechnological applications. Applied Microbiology and Biotechnology 57(1-2): 9-13.
Karimian, R., Lahouti, M. and Davarpanah, S. J. (2015) Effects of different concentrations of 2,4-D and kinetin on callogenesis of Taxus brevifolia Nutt. Journal of Applied Biotechnology Reports 1(4): 167-170.
Ketchum, R. B. E. and Croteau, R. (1998) Recent progress toward an understanding of taxol biosynthesis in plant cell cultures. Elsevier Science, Amsterdam.
Khosroushahi, A. Y., Valizadeh, M., Ghasempour, A., Khosrowshahli, M., Naghdibadi, H., Dadpour, M. R. and Omidi, Y. (2006) Improved taxol production by combination of inducing factors in suspension cell culture of Taxus baccata. Cell Biology International 30(3): 262-269.
Lesani, M. R. (1999) Yew. Mministry of Jahad-e-Sazandegi Pub, Tehran (in Persian).
Miller, R. W. and Brief, A. (1980) Survy of taxus alkaloids and other taxane derivatives. Journal of Natural Products 43: 425-437.
Mossadegh, A. (1993) Yew tree. Research Report of University of California, Berkeley.
Rao, R. S. and Ravishankar, G. A. (2002) Plant tissue cultures, chemical factories of secondary metabolites. Biochemistry and Pharmacology 20: 101-153.
Schulz, B. and Boyle, C. (2006) What are endophytes. In: Microbial root endophytes (Eds. Schulz, B., Boyle, C. and Seiber, T.) 1-13. Springer, Berlin.
Shirazi, Z., Piri, Kh., Mirzaiy asl, A., Hasanlo, T. and Ghiasond, T. (2013) The effect of salicylic acid and methyl jasmonate acid on the productivity of glycyrrhizin and isolucoetiline in Glycyrrhiza glabra L. Root. Journal of Plant Breeding (Iranian Journal of Biology) 27(3): 449-440 (in Persian).
Sinha, R. and Vidyarthi, A. S. (2011) A molecular docking study of anticancer drug paclitaxel and its analogues. Indian Journal of Biochemistry and Biophysics 48(2): 101-105.
Strobel, G., Yang, X. S., Sears, J., Kramer, R., Sidhu, R. S. and Hess, W. M. (1996) Taxol from Pestalotiopsis microspora an endophytic fungus of Taxus wallachiana. Microbiology 142: 435-440.
Wang, J. F., Li, G. L., Lu, H. Y., Zheng, Z. H., Huang, Y. J. and Su, W. J. (2000) Taxol from Tubercularia sp. strain TF5 an endophytic fungus of Taxus mairei. FEMS Microbiology Letters 193(2): 249-253,
Wani, M. C., Taylor, H. L., Wall, M. E., Coggon, P. and McPhail, A. T. (1971) Plant antitumor agents. VI. Isolation and structure of taxo. a novel antileukemic and antitumor agent from Taxus brevifolia. Journal of the American Chemical Society 93(9): 2325-2327.
Weber, D. (2009) Endophytic fungi, occurrence and metabolites. In: The Mycota, Vol. XV, Physiology and genetics selected basic and applied aspects (Eds. Anke, T. and Weber, D.). 153-195. Springer-Verlag, Berlin.
Woods, M. C., Nakanishi, K. and Bhacca, N. S. (1996) The NMR Spectra of taxinine and its derivatives. Tetrahedron 22: 243-260.
Yarikhosroshahi, A. (2004) Investigating the response to tissue culture in the yew and the amount of taxol produced in in vitro conditions. MSc thesis, Tabriz University, Tabriz, Iran (in Persian).
Zhang, P., Zhou, P-p., Jiang, C., Yu, H. and Yu, L-j. (2008) Screening of taxol-producing fungi based on PCR amplification from Taxus. Biotechnology Letters 30(12): 2119-2123.